SubtiWiki SubtiWiki
yyaM

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!

yyaM
168

unknown

locus
BSU_40810
Molecular weight
32.74 kDa
pI
10.44
Protein length
Gene length
function
unknown
product
unknown
essential
no
ec
null
synonyms
yyaM

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0697

This gene is a member of the following regulons

Gene
Coordinates
4,190,209 → 4,191,126
The protein
Protein family
[wiki|EamA transporter family] (according to UniProt)
[wiki|Domains]
2 [wiki|EamA domain]s (aa 15-140, aa 164-290) (according to UniProt)
[wiki|Localization]
cell membrane (according to UniProt)
Expression and Regulation
Operons
genes
[gene|852ECFA6F254167090AA393E6E0D269F49A4CC6E|yyaN]-[gene|D9D907A6004AFE7A4D7BB92A8955593F00DC7A2C|yyaM]-[gene|56A5266F8F42E0FCFDE941CB71AD103120CEB5E9|yyaL]
description
[Pubmed|22383849]
Open in new tab

[gene|852ECFA6F254167090AA393E6E0D269F49A4CC6E|yyaN]→[gene|56A5266F8F42E0FCFDE941CB71AD103120CEB5E9|yyaL]

2021-12-29 12:27:01

Jstuelk

8

dae36084e0a18eee42d8f69fcaaf519fcef43d33

C86B2672974B1551D3E5779BC0C0D78FB55E202D

Biological materials
Mutant
MGNA-B861 (yyaM::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1860 NBRP B. subtilis, Japan]
BKE40810 (Δ[gene|D9D907A6004AFE7A4D7BB92A8955593F00DC7A2C|yyaM]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE40810 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTATGTATATATTTAAAT,  downstream forward: _UP4_TAAAGAAATAGGGAGTATTT
BKK40810 (Δ[gene|D9D907A6004AFE7A4D7BB92A8955593F00DC7A2C|yyaM]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK40810 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTATGTATATATTTAAAT,  downstream forward: _UP4_TAAAGAAATAGGGAGTATTT

D9D907A6004AFE7A4D7BB92A8955593F00DC7A2C

Page visits: 935

Time of last update: 2022-01-07 11:57:18

Author of last update: Melvin.boenninger