SubtiWiki SubtiWiki
ackA
The European Conference @BACELL 2021 will be held 26th - 27th August in Prague - please register until the 20th of July, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

ackA
168

acetate kinase

locus
BSU_29470
Molecular weight
42.98 kDa
pI
5.19
Protein length
Gene length
function
overflow metabolism
product
acetate kinase
essential
no
ec
2.7.2.1
synonyms
ackA

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0282

This gene is a member of the following regulons

Gene
Coordinates
3,015,111 3,016,298
The protein
Catalyzed reaction/ biological activity
acetate + ATP --> acetyl phosphate + ADP (according to UniProt)
Protein family
acetokinase family (with [protein|8E08A0333E4EC89003DA3C1DD8DCD39CDDC8624C|buk], according to UniProt)
Structure
[PDB|2IIR] (from ''Thermotoga maritima'', 54% identity, 73% similarity)
[wiki|Localization]
cytoplasm (according to Swiss-Prot)
Additional information
belongs to the 100 most abundant proteins [PubMed|15378759]
Expression and Regulation
Operons
genes
[gene|DAA285C86692E8B47D48652E0973AE3FF091CBC3|ackA]
description
[Pubmed|8226682]
regulation
activated during growth in the presence of branched chain amino acids ([protein|search|CodY]) [Pubmed|16995897]
regulatory mechanism
[protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY]: activation, [Pubmed|16995897], in [regulon|protein:90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY regulon]
[protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA]: activation, [Pubmed|8226682,12850135], in [regulon|protein:E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|8226682], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|DAA285C86692E8B47D48652E0973AE3FF091CBC3|ackA]

2021-09-18 05:53:57

ghost

4

dd206a197661afbecfae8fedfc7263549fe2c0ff

2A1BE4F157042B98F7609BFE76D2AD0293E31FBB

Biological materials
Mutant
GP1902 (''ackA''::''aphA3'') (available in [wiki|Jrg Stlke]'s lab)
BKE29470 ([gene|DAA285C86692E8B47D48652E0973AE3FF091CBC3|ackA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE29470 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGATTGACGCTCCTTTAT, downstream forward: _UP4_TAAATCGCATGAAAGCACAT
BKK29470 ([gene|DAA285C86692E8B47D48652E0973AE3FF091CBC3|ackA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK29470 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGATTGACGCTCCTTTAT, downstream forward: _UP4_TAAATCGCATGAAAGCACAT
two-hybrid system
''B. pertussis'' adenylate cyclase-based bacterial two hybrid system ([wiki|BACTH]), available in [wiki|Jrg Stlke]'s lab
labs
[wiki|Linc Sonenshein], Tufts University, Boston, MA, USA [http://www.tufts.edu/sackler/microbiology/faculty/sonenshein/index.html Homepage]
References
Reviews
16678422,15755952
Original Publications
8226682,9811655,15378759,11244084,16995897,12850135,8226682,9811655,21106498,26098117

DAA285C86692E8B47D48652E0973AE3FF091CBC3

Page visits: 4104

Time of last update: 2021-09-22 13:39:23

Author of last update: Melvin.boenninger