hutH

At Gram+ 2022 in Prague, there will be a workshop on how to get the most out of SubtiWiki. We will present newly added features. Moreover, we hope to learn from you what you would like to have added to SubtiWiki to improve it!

hutH
168

histidase

locus
BSU_39350
Molecular weight
55.51 kDa
pI
5.22
Protein length
Gene length
function
histidine utilization
product
histidase
essential
no
ec
4.3.1.3
synonyms
hutH

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG2986

This gene is a member of the following regulons

Gene
Coordinates
4,042,051 → 4,043,577
The protein
Catalyzed reaction/ biological activity
L-histidine --> NH4+ + trans-urocanate (according to Swiss-Prot)
Protein family
PAL/histidase family (single member, according to UniProt)
Structure
[PDB|1B8F] (from ''Pseudomonas putida'', 43% identity, 62% similarity) [Pubmed|10220322]
[AF|P10944]
[wiki|Localization]
cytoplasm (according to Swiss-Prot)
Expression and Regulation
Operons
genes
[gene|BCA2700F27CA7A0C3FC08AAEBE615A783A42F408|hutP]-[gene|DB0FDF43A6829692D3E6B9CDE9D0F4AA1E3EB888|hutH]-[gene|ED6002BB56B96F9A2B4F80CA050518B266000E55|hutU]-[gene|BD3382760B704972A0E67ECEDA4B29AA4ECD8164|hutI]-[gene|FBB15E07B7134C57208EA82D5339708385DBC5FB|hutG]-[gene|423AEC9D260BE53AD22851D999244B89BEB3E84D|hutM]
description
[Pubmed|10746760]
regulation
induced by histidine ([protein|search|HutP]) [Pubmed|8071225]
regulatory mechanism
[protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA]: repression, [Pubmed|8071225], in [regulon|protein:E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA regulon]
[protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY]: repression, [Pubmed|8682780], in [regulon|protein:90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY regulon]
[protein|BCA2700F27CA7A0C3FC08AAEBE615A783A42F408|hutP]: antitermination, at a protein-dependent [wiki|RNA switch] located between [gene|BCA2700F27CA7A0C3FC08AAEBE615A783A42F408|hutP] and [gene|DB0FDF43A6829692D3E6B9CDE9D0F4AA1E3EB888|hutH] [Pubmed|8071225], in [regulon|protein:BCA2700F27CA7A0C3FC08AAEBE615A783A42F408|hutP regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|8071225], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|BCA2700F27CA7A0C3FC08AAEBE615A783A42F408|hutP]→[gene|423AEC9D260BE53AD22851D999244B89BEB3E84D|hutM]

2022-04-28 01:45:51

ghost

20

cf3eb91928f3fe61cbc0cd204535c4f9c144314a

0AE45FCE38B0E774CFFC5F6A0A98EEDF6B02F4D4

Biological materials
Mutant
GP1114 (hutH::Tn10, spc), available in [wiki|Stülke] lab
BKE39350 (Δ[gene|DB0FDF43A6829692D3E6B9CDE9D0F4AA1E3EB888|hutH]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE39350 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATAAGCCCAACTCCTTTTT,  downstream forward: _UP4_AAAGAACTAAGGGGGATGAA
BKK39350 (Δ[gene|DB0FDF43A6829692D3E6B9CDE9D0F4AA1E3EB888|hutH]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK39350 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATAAGCCCAACTCCTTTTT,  downstream forward: _UP4_AAAGAACTAAGGGGGATGAA
References
Reviews
22933560
Original Publications
10746760,6143742,8071225,8682780,10217782

DB0FDF43A6829692D3E6B9CDE9D0F4AA1E3EB888

Page visits: 1125

Time of last update: 2022-05-17 21:12:23

Author of last update: Melvin.boenninger