ybbK

ybbK
168

unknown

locus
BSU_01720
Molecular weight
15.55 kDa
pI
5.31
Protein length
Gene length
function
unknown
product
unknown
essential
no
ec
null
synonyms
ybbK

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1683

This gene is a member of the following regulons

Gene
Coordinates
193,570 → 194,025
The protein
Structure
[AF|Q45584]
Biological materials
Mutant
BKE01720 (Δ[gene|DB52F9DB4212FABC87E41F374DCD2DEBCEEE4DF8|ybbK]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE01720 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATATTGGTTTCTCCTCTCT,  downstream forward: _UP4_GACATATTGTAAGGAGGCCA
BKK01720 (Δ[gene|DB52F9DB4212FABC87E41F374DCD2DEBCEEE4DF8|ybbK]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK01720 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATATTGGTTTCTCCTCTCT,  downstream forward: _UP4_GACATATTGTAAGGAGGCCA

DB52F9DB4212FABC87E41F374DCD2DEBCEEE4DF8

Page visits: 1148

Time of last update: 2022-11-26 20:51:28

Author of last update: Bzhu