

thiol-disulfide oxidoreductase

Molecular weight
16.04 kDa
Protein length
Gene length
oxidative folding of proteins
thiol-disulfide oxidoreductase
bdbA, yolI

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG3118

This gene is a member of the following regulons

2,266,936 → 2,267,349
The protein
Protein family
[wiki|Thioredoxin family] (according to UniProt)
[wiki|Thioredoxin domain] (aa 26-136) (according to UniProt)
secreted (according to UniProt)
Expression and Regulation
repressed by [protein|1508770D5BCA5739D13E3ABD11CC5C103C07FF25|rok]-[wiki|DnaA] [Pubmed|27902860,15743949]
expression starts in the stationary phase [pubmed|30808982]
expression is heterogeneous in the population, this is mediated by [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|abrB], [protein|1508770D5BCA5739D13E3ABD11CC5C103C07FF25|rok], and [protein|2C54FE2ADC82FF414D732018C90649D477A925AD|spo0A] [pubmed|30808982]
regulatory mechanism
[protein|1508770D5BCA5739D13E3ABD11CC5C103C07FF25|rok]: repression, [Pubmed|15743949], in [regulon|protein:1508770D5BCA5739D13E3ABD11CC5C103C07FF25|rok regulon]
[protein|5872812AB61E92E2944E926915EB7FEE71BFA6D5|abh]: activation, [Pubmed|20817675,19465659], in [regulon|protein:5872812AB61E92E2944E926915EB7FEE71BFA6D5|abh regulon]
[protein|6740108089F13116F200C15F35C2E7561E990FEB|dnaA]: repression, [protein|1508770D5BCA5739D13E3ABD11CC5C103C07FF25|rok]-[protein|6740108089F13116F200C15F35C2E7561E990FEB|dnaA] [Pubmed|27902860,15743949], in [regulon|protein:6740108089F13116F200C15F35C2E7561E990FEB|dnaA regulon]
[protein|7098319D8E88FDC2A629A3F4A21507FD7A649385|yvrHb]: activation, [Pubmed|16306698], in [regulon|protein:7098319D8E88FDC2A629A3F4A21507FD7A649385|yvrHb regulon]
[protein|E5110D9C36E8C55AFD1419987B14A53232165F20|abrB]: repression, [Pubmed|20817675,17720793], in [regulon|protein:E5110D9C36E8C55AFD1419987B14A53232165F20|abrB regulon]
additional information
the mRNA is very stable (> 15 min) [pubmed|12884008]
the amount of the mRNA is substantially decreased upon depletion of [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [PubMed|21815947]
Open in new tab


2022-11-26 01:28:20





Biological materials
BKE21460 (Δ[gene|DB5F719C0A2F610301E174F6890DA9E826C76932|bdbA]::erm  trpC2) available at [ BGSC],  [Pubmed|28189581], upstream reverse: _UP1_TTTCATATAGAATACTCCTT,  downstream forward: _UP4_TTTGATAAAAATGGTGATAG
BKK21460 (Δ[gene|DB5F719C0A2F610301E174F6890DA9E826C76932|bdbA]::kan  trpC2) available at [ BGSC],  [Pubmed|28189581], upstream reverse: _UP1_TTTCATATAGAATACTCCTT,  downstream forward: _UP4_TTTGATAAAAATGGTGATAG


Page visits: 2251

Time of last update: 2022-11-29 16:05:49

Author of last update: Melvin.boenninger