SubtiWiki SubtiWiki
ydfC

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!

ydfC
168

unknown

locus
BSU_05360
Molecular weight
33.41 kDa
pI
9.86
Protein length
Gene length
function
unknown
product
unknown
essential
no
ec
null
synonyms
ydfC

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0697

This gene is a member of the following regulons

Gene
Coordinates
582,536 → 583,456
The protein
Protein family
[wiki|EamA transporter family] (according to UniProt)
[wiki|Domains]
2 [wiki|EamA domain]s (aa 17-140, aa 160-285) (according to UniProt)
[wiki|Localization]
cell membrane (according to UniProt)
Biological materials
Mutant
MGNA-C143 (ydfC::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2141 NBRP B. subtilis, Japan]
BKE05360 (Δ[gene|DB6054A37D2EC1C1961C49825AF74171FADF1A3B|ydfC]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE05360 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTCCTCTCACTCCTCTTT,  downstream forward: _UP4_TAAAACAAAAAAGATACCAA
BKK05360 (Δ[gene|DB6054A37D2EC1C1961C49825AF74171FADF1A3B|ydfC]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK05360 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTCCTCTCACTCCTCTTT,  downstream forward: _UP4_TAAAACAAAAAAGATACCAA

DB6054A37D2EC1C1961C49825AF74171FADF1A3B

Page visits: 833

Time of last update: 2021-11-20 16:20:00

Author of last update: Melvin.boenninger