spoIVB

spoIVB
168

serine protease (site 1 protease), cleaves [protein|AB2A3422277040107AAF90358BBE58608F8E0738|spoIVFA] to prepare it for [protein|85247AD09B7A472607B32D57E6318BA6C83EC6BA|ctpB] cleavage, this results in pro-[protein|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|sigK] processing/activation in the mother-cell, does also cleave [protein|85247AD09B7A472607B32D57E6318BA6C83EC6BA|ctpB]

locus
BSU_24230
Molecular weight
45.81 kDa
pI
8.84
Protein length
Gene length
function
control of [protein|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|sigK] activation
product
serine protease
essential
no
synonyms
spoIVB

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG5832

This gene is a member of the following regulons

Gene
Coordinates
2,519,102 → 2,520,382
The protein
Catalyzed reaction/ biological activity
Self-cleaves 52-Val-|-Asn-53, 62-Ala-|-Phe-63 and 74-Val-|-Thr-75 at the N-terminus of SpoIVB (according to UniProt)
Protein family
PDZ protease [Pubmed|24243021]
[wiki|Domains]
[wiki|PDZ domain] (aa 101 - 187) (according to UniProt)
Peptidase S55 domain (aa 188-426) (according to UniProt)
Structure
[AF|P17896]
[wiki|Localization]
secreted from the forespore to the intracellular space between the mother cell and the forespore [Pubmed|24243021]
Expression and Regulation
Operons
genes
[gene|DBB3ED60A7D162B9F2830F81041BC661AA5EC1E7|spoIVB]
description
[Pubmed|2106508]
regulation
expressed during sporulation in the forespore ([protein|search|SigF], [protein|search|SigG], [wiki|SpoVT]) [Pubmed|16497325,15699190,9004507,8755877]
regulatory mechanism
[protein|01EF886D3D004EA9B22AC5E75D50FF07D8631E68|spoVT]: activation, [Pubmed|8755877], in [regulon|protein:01EF886D3D004EA9B22AC5E75D50FF07D8631E68|spoVT regulon]
sigma factors
[protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|sigF]: sigma factor, [Pubmed|15699190,9004507], in [regulon|protein:CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|sigF regulon]
[protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG]: sigma factor, [Pubmed|15699190,9004507], in [regulon|protein:5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG regulon]
Open in new tab

[gene|DBB3ED60A7D162B9F2830F81041BC661AA5EC1E7|spoIVB]

2022-12-30 13:23:07

ghost

26

acd97afd84625406d11a64dc87c9c0bf9c73ec31

16DC1EB96241822C6B6A8E05BC0AAAB06F7C0F9A

Biological materials
Mutant
BKE24230 (Δ[gene|DBB3ED60A7D162B9F2830F81041BC661AA5EC1E7|spoIVB]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE24230 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTCACTACTTCACTCTCC,  downstream forward: _UP4_TGACTGCCGGAGTTTCCGGC
BKK24230 (Δ[gene|DBB3ED60A7D162B9F2830F81041BC661AA5EC1E7|spoIVB]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK24230 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTCACTACTTCACTCTCC,  downstream forward: _UP4_TGACTGCCGGAGTTTCCGGC
labs
Simon Cutting, London, UK [http://personal.rhul.ac.uk/uhba/009/bacillus/simon_cutting.html homepage]
References
Reviews
31350897,33538382,35638784
Original Publications
17493131,2106508,10931284,14526016,10931291,1900494,11418578,15292188,9004507,12940997,11741860,16497325,8755877,24243021,15292188,17557826,16818230,30403663

DBB3ED60A7D162B9F2830F81041BC661AA5EC1E7

Page visits: 1981

Time of last update: 2023-02-06 02:18:34

Author of last update: Jstuelk