gerKD

gerKD
168

negative effector (D protein) of the [protein|EDB2F4C132211F01654F2A2ED3D220EC15CE6F22|gerKA]-[protein|D1AFCB1BE693AB6B8461B7764B6641E6EB1404FA|gerKB]-[protein|D5D4E1E182F972BEF6BB432A7FF25EF45F1F0D95|gerKC] germinant receptor

locus
BSU_03690
Molecular weight
8.25 kDa
pI
10.01
Protein length
Gene length
function
germination
product
negative effector of the [protein|EDB2F4C132211F01654F2A2ED3D220EC15CE6F22|gerKA]-[protein|D1AFCB1BE693AB6B8461B7764B6641E6EB1404FA|gerKB]-[protein|D5D4E1E182F972BEF6BB432A7FF25EF45F1F0D95|gerKC] germinant receptor
essential
no
synonyms
gerKD, yczF

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms

This gene is a member of the following regulons

Gene
Coordinates
419,763 → 419,984
Phenotypes of a mutant
faster [wiki|germination] with the AGFK germinant mixture [Pubmed|23625846]
higher sensitivity to AGFK germinants ([wiki|germination] at lower concentrations) [Pubmed|23625846]
The protein
Structure
[AF|O31479]
[wiki|Localization]
membrane (according to UniProt)
Expression and Regulation
Operons
genes
[gene|DBC4A2711F5079AF1C1B743DA8D7A813DAA0827F|gerKD]
description
[Pubmed|22383849]
regulation
expressed during [wiki|sporulation] in the forespore ([protein|search|SigG]) [Pubmed|23625846]
sigma factors
[protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG]: sigma factor, [Pubmed|23625846], in [regulon|protein:5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG regulon]
Open in new tab

[gene|DBC4A2711F5079AF1C1B743DA8D7A813DAA0827F|gerKD]

2022-12-12 12:00:30

ghost

18

8b28be5b0a84218edef3ee673e3a30f13b3cbcc7

19EBA724F94BF2197BF8E3BB4AB7D137980582AD

Biological materials
Mutant
BKE03690 (Δ[gene|DBC4A2711F5079AF1C1B743DA8D7A813DAA0827F|gerKD]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE03690 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGCTTCATCATCCTCCGC,  downstream forward: _UP4_AACCCCTAAAGGGGGGCGCT
BKK03690 (Δ[gene|DBC4A2711F5079AF1C1B743DA8D7A813DAA0827F|gerKD]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK03690 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGCTTCATCATCCTCCGC,  downstream forward: _UP4_AACCCCTAAAGGGGGGCGCT
References
23625846,22383849,27766092

DBC4A2711F5079AF1C1B743DA8D7A813DAA0827F

Page visits: 1233

Time of last update: 2023-02-02 09:25:07

Author of last update: Jstuelk