yhcZ

yhcZ
168

two-component response regulator

locus
BSU_09330
Molecular weight
23.88 kDa
pI
5.9
Protein length
Gene length
function
unknown
product
two-component response regulator
essential
no
synonyms
yhcZ

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG2197

This gene is a member of the following regulons

Gene
Coordinates
1,009,804 → 1,010,448
The protein
[wiki|Domains]
[wiki|Response regulatory domain] (aa 2-118) (according to UniProt)
[wiki|HTH luxR-type domain] (aa 142-207) (according to UniProt)
Structure
[PDB|5HEV] ([protein|search|LiaR ]from Enterococcus faecium, 44% identity) [pubmed|27670715]
[AF|O07528]
Modification
phosphorylated on a Asp residue by [protein|8D570AEE5D78A9A3CDBB1F457630BAF5DB59BCFD|yhcY]
Paralogous protein(s)
[protein|EFEAF09E4449A022A7323450FDED9458426A0080|ydfI], [protein|23F365C23BDEE02D42C9355FC7D2A65DAF9F79ED|yxjL], [protein|387EF370CE24F7A3C20789A57329A02EBED46F53|lnrK], [protein|49E70A20CC05DBE485953C0AE34E634EFB33C3B2|liaR]
[wiki|Localization]
cytoplasm (according to Swiss-Prot)
Expression and Regulation
Operons
genes
[gene|8D570AEE5D78A9A3CDBB1F457630BAF5DB59BCFD|yhcY]-[gene|DD799ED3EB79457C27ED30C7B4DBBC2C8F962191|yhcZ]-[gene|345EC248C0ADF48B0C25B175241AAE982E0E9B78|yhdA]
description
[Pubmed|16816187]
regulatory mechanism
[protein|49E70A20CC05DBE485953C0AE34E634EFB33C3B2|liaR]: activation, [Pubmed|16816187], in [regulon|protein:49E70A20CC05DBE485953C0AE34E634EFB33C3B2|liaR regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|16816187], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|8D570AEE5D78A9A3CDBB1F457630BAF5DB59BCFD|yhcY]→[gene|345EC248C0ADF48B0C25B175241AAE982E0E9B78|yhdA]

2022-12-14 01:36:54

ghost

20

8cc56cf62393d735d27584617b4d54806f9369b1

5E51555D7512C898216E1762D43B864CFD152408

Biological materials
Mutant
MGNA-A730 (yhcZ::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/730 NBRP B. subtilis, Japan]
BKE09330 (Δ[gene|DD799ED3EB79457C27ED30C7B4DBBC2C8F962191|yhcZ]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE09330 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_TTTCATACCGCCCCTCCTTT,  downstream forward: _UP4_AAATGAACATGTTAGTCATA
BKK09330 (Δ[gene|DD799ED3EB79457C27ED30C7B4DBBC2C8F962191|yhcZ]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK09330 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_TTTCATACCGCCCCTCCTTT,  downstream forward: _UP4_AAATGAACATGTTAGTCATA
References
10094672,20639339,16816187,27670715,29785949

DD799ED3EB79457C27ED30C7B4DBBC2C8F962191

Page visits: 2054

Time of last update: 2023-01-28 22:17:07

Author of last update: Melvin.boenninger