ykuC

ykuC
168

similar to macrolide-efflux protein

locus
BSU_14030
Molecular weight
47.93 kDa
pI
9.92
Protein length
Gene length
function
unknown
product
unknown
essential
no
synonyms
ykuC

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms

This gene is a member of the following regulons

Gene
Coordinates
1,475,150 → 1,476,442
Phenotypes of a mutant
increased conjugation of ICEBs1 [Pubmed|25069588]
The protein
Protein family
[wiki|major facilitator superfamily] (according to UniProt)
Structure
[AF|O31695]
[wiki|Localization]
cell membrane (according to UniProt)
Expression and Regulation
Operons
genes
[gene|253A24EEA02C07E577A96FB64DF39F9A3D0C3A52|ykuE]-[gene|6F256986E591DB82974A7F54EB1CE0C024A6F63B|ldt]-[gene|DDAE68CD8D7F0D9C46E62D0EDBF4631C9EC4C236|ykuC]
description
[Pubmed|22383849]
regulation
expressed during sporulation in the mother cell ([protein|search|SigK]) [Pubmed|11011148]
Open in new tab

[gene|253A24EEA02C07E577A96FB64DF39F9A3D0C3A52|ykuE]→[gene|DDAE68CD8D7F0D9C46E62D0EDBF4631C9EC4C236|ykuC]

2022-11-29 05:48:29

ghost

26

900f4f5bf9b6f18854e49d4fcb50b165e30a6ce2

AB2193A8638597380A2AEFF9607482D0824BD9F0

Biological materials
Mutant
MGNA-A765 (ykuC::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/765 NBRP B. subtilis, Japan]
BKE14030 (Δ[gene|DDAE68CD8D7F0D9C46E62D0EDBF4631C9EC4C236|ykuC]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE14030 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATAAAAACGCTCCTTACCC,  downstream forward: _UP4_TAATGCAGGTTAAAAATGCG
BKK14030 (Δ[gene|DDAE68CD8D7F0D9C46E62D0EDBF4631C9EC4C236|ykuC]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK14030 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATAAAAACGCTCCTTACCC,  downstream forward: _UP4_TAATGCAGGTTAAAAATGCG
References
22383849,25069588

DDAE68CD8D7F0D9C46E62D0EDBF4631C9EC4C236

Page visits: 1061

Time of last update: 2022-11-24 16:41:56

Author of last update: Melvin.boenninger