tlp

tlp
168

thioredoxin-like protein

locus
BSU_18030
Molecular weight
9.58 kDa
pI
4.44
Protein length
Gene length
function
unknown
product
thioredoxin-like protein
essential
no
synonyms
tlp

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG5863

This gene is a member of the following regulons

Gene
Coordinates
1,930,447 → 1,930,698
The protein
Protein family
tlp family (single member, according to UniProt)
Structure
[AF|Q45060]
[wiki|Localization]
spore core (according to Swiss-Prot)
Expression and Regulation
Operons
genes
[gene|5D79D9D38B588FE0EC688D54FE68E6F49238DA46|sspN]-[gene|DE52E15D900F9665E35D2C8138DA3ABFC2B7B723|tlp]
description
[Pubmed|10333516]
regulation
expressed during sporulation in the forespore ([protein|search|SigF], [protein|search|SigG]) [Pubmed|15699190,10333516]
sigma factors
[protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|sigF]: sigma factor, [Pubmed|15699190,10333516], in [regulon|protein:CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|sigF regulon]
[protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG]: sigma factor, [Pubmed|15699190,10333516], in [regulon|protein:5F24258282F3166B7696B9E9ABC1706E4D06C944|sigG regulon]
Open in new tab

[gene|5D79D9D38B588FE0EC688D54FE68E6F49238DA46|sspN]→[gene|DE52E15D900F9665E35D2C8138DA3ABFC2B7B723|tlp]

2022-12-10 23:30:27

ghost

17

8757a4161c7c7017b6527853073d00cd7adc790d

E3663BCFF3D69A8223B9D0560AEF3E5D7F092C1D

additional information
the mRNA belongs to the 46 most abundant mRNA species in dormant spores [pubmed|30782632]
Biological materials
Mutant
BKE18030 (Δ[gene|DE52E15D900F9665E35D2C8138DA3ABFC2B7B723|tlp]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE18030 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTCGGATGTACCTCCTAG,  downstream forward: _UP4_TAAAAAACCAGGGAAACCTG
BKK18030 (Δ[gene|DE52E15D900F9665E35D2C8138DA3ABFC2B7B723|tlp]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK18030 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTCGGATGTACCTCCTAG,  downstream forward: _UP4_TAAAAAACCAGGGAAACCTG
References
Reviews
35638784
Original Publications
16497325,15699190,10333516,30782632

DE52E15D900F9665E35D2C8138DA3ABFC2B7B723

Page visits: 1030

Time of last update: 2023-02-02 09:25:25

Author of last update: Jstuelk