yfiV

At Gram+ 2022 in Prague, there will be a workshop on how to get the most out of SubtiWiki. We will present newly added features. Moreover, we hope to learn from you what you would like to have added to SubtiWiki to improve it!

yfiV
168

similar to transcriptional regulator ([wiki|MarR family])

locus
BSU_08410
Molecular weight
18.07 kDa
pI
6.52
Protein length
Gene length
function
unknown
product
unknown
essential
no
ec
null
synonyms
yfiV

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1846

This gene is a member of the following regulons

Gene
Coordinates
916,124 → 916,606
The protein
[wiki|Domains]
[wiki|HTH marR-type domain] (aa 20-152) (according to UniProt)
Structure
[PDB|6JBX] (from Streptococcus pneumoniae, corresponds to aa 46 ... 158, 28% identity) [pubmed|31291684]
[AF|O31564]
Expression and Regulation
Operons
genes
[gene|DE880F5577B6D86B2E62437E392D48AFA9BCE48B|yfiV]
description
[pubmed|22383849]
Open in new tab

[gene|DE880F5577B6D86B2E62437E392D48AFA9BCE48B|yfiV]

2022-01-25 01:40:15

Jstuelk

4

2a190b39d619ab351baf48055a3fdb9a7fb3ed70

DF88722154A2764500766DE8A69EC420ECA6BC04

Biological materials
Mutant
MGNA-C357 (yfiV::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2355 NBRP B. subtilis, Japan]
BKE08410 (Δ[gene|DE880F5577B6D86B2E62437E392D48AFA9BCE48B|yfiV]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE08410 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTTCATCACTTCCTCATC,  downstream forward: _UP4_TAAATCAGTAAGTCTGTCAT
BKK08410 (Δ[gene|DE880F5577B6D86B2E62437E392D48AFA9BCE48B|yfiV]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK08410 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTTCATCACTTCCTCATC,  downstream forward: _UP4_TAAATCAGTAAGTCTGTCAT
References
Research papers
31291684

DE880F5577B6D86B2E62437E392D48AFA9BCE48B

Page visits: 1349

Time of last update: 2022-05-17 18:27:23

Author of last update: Jstuelk