albA

albA
168

radical S-adenosylmethionine enzyme, antilisterial bacteriocin (subtilosin) production

locus
BSU_37370
Molecular weight
51.35 kDa
pI
6.2
Protein length
Gene length
function
antilisterial bacteriocin (subtilosin) production
product
radical S-adenosylmethionine enzyme
essential
no
synonyms
albA, ywiA

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0535

This gene is a member of the following regulons

Gene
Coordinates
3,836,323 → 3,837,669
The protein
Catalyzed reaction/ biological activity
catalyzes thioether bond formation in subtilosin A [Pubmed|22366720]
[wiki|Cofactors]
contains two Fe-S clusters [Pubmed|22366720]
Structure
[PDB|6EFN] ([protein|F981C605C652D1A4429579A5F24608CE7F570834|skfB],corresponds to aa 109 ... 382, 32% identity) [pubmed|30217813]
[AF|P71011]
Expression and Regulation
Operons
genes
[gene|8CBBEC47A5CC3EAE73BE68E68417C5F2A4DA5C23|sboA]-[gene|83AAFAA187B4FCEE24B4EA2DD4935425A3B48DAA|sboX]-[gene|DEDA6F03386F360F6C0B2CC5F09DF3C9D85173F1|albA]-[gene|D399B25AE22ECB6C7ACDCFF4DCE4D9D908184E75|albB]-[gene|19CC58F5ABADAD45BA55D88BBD77B586AA5D85FE|albC]-[gene|DAD8308DF72E648610D1A12BC92063E1550CB1B4|albD]-[gene|A474F01AA4AD859963E39CD528BC42FF43A72433|albE]-[gene|D03FB4EAEFBC25A5B0459CF464BFADF1FC7620B2|albF]-[gene|55A34610EF7AA5E515DE3DCDA333ED3A42B0EF08|albG]
description
[Pubmed|10572140]
regulation
expressed under anaerobic conditions ([protein|1E829D639BADDC6BDC9B5FB4C97A632A53FDDB24|resD]) [Pubmed|10809710]
expression
expression is heterogeneous [pubmed|35171018]
regulatory mechanism
[protein|1508770D5BCA5739D13E3ABD11CC5C103C07FF25|rok]: repression, [Pubmed|15743949], in [regulon|protein:1508770D5BCA5739D13E3ABD11CC5C103C07FF25|rok regulon]
[protein|1E829D639BADDC6BDC9B5FB4C97A632A53FDDB24|resD]: activation, [Pubmed|10809710], in [regulon|protein:1E829D639BADDC6BDC9B5FB4C97A632A53FDDB24|resD regulon]
[protein|E5110D9C36E8C55AFD1419987B14A53232165F20|abrB]: repression, [PubMed|10572140,17720793], in [regulon|protein:E5110D9C36E8C55AFD1419987B14A53232165F20|abrB regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|10572140], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|8CBBEC47A5CC3EAE73BE68E68417C5F2A4DA5C23|sboA]→[gene|55A34610EF7AA5E515DE3DCDA333ED3A42B0EF08|albG]

2022-11-25 02:57:05

Jstuelk

45

ED4C73B393EFE70C9997D5F8774AA65E87AA8132

4E5A98D6615C53214EC58E0D67F433A287A88522

Biological materials
Mutant
MGNA-B263 (ywiA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1262 NBRP B. subtilis, Japan]
BKE37370 (Δ[gene|DEDA6F03386F360F6C0B2CC5F09DF3C9D85173F1|albA]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE37370 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAAAATACCATCCCCTATAC,  downstream forward: _UP4_CAGCTTATTTAGGAGGGAAA
BKK37370 (Δ[gene|DEDA6F03386F360F6C0B2CC5F09DF3C9D85173F1|albA]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK37370 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAAAATACCATCCCCTATAC,  downstream forward: _UP4_CAGCTTATTTAGGAGGGAAA
References
10809709,10572140,15743949,10809710,10572140,17720793,17190806,30217813,35171018

DEDA6F03386F360F6C0B2CC5F09DF3C9D85173F1

Page visits: 2422

Time of last update: 2022-11-28 22:34:47

Author of last update: Jstuelk