SubtiWiki SubtiWiki
yceD

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!

yceD
168

general stress protein, similar to tellurium resistance protein

locus
BSU_02900
Molecular weight
20.55 kDa
pI
4.29
Protein length
Gene length
function
required for survival of ethanol stress
product
unknown
essential
no
synonyms
yceD

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG2310

This gene is a member of the following regulons

Gene
Coordinates
312,780 → 313,361
The protein
Protein family
CAPAB/TerDEXZ family (with [protein|7E4742F30B4C43FBF9DAE0B02948022AE7912A33|yceC] and [protein|863E26D497D29B820912A0C0F4A3AE4C6865EC2E|yceE], according to UniProt)
Structure
[PDB|2KXT] (from Klebsiella pneumoniae, 59% identity) [pubmed|21112337]
Paralogous protein(s)
[protein|7E4742F30B4C43FBF9DAE0B02948022AE7912A33|yceC], [protein|863E26D497D29B820912A0C0F4A3AE4C6865EC2E|yceE]
[wiki|Localization]
membrane associated [Pubmed|18763711]
Expression and Regulation
Operons
genes
[gene|7E4742F30B4C43FBF9DAE0B02948022AE7912A33|yceC]-[gene|DF30A8B195B8D830E131B23C768F07BE61F51150|yceD]-[gene|863E26D497D29B820912A0C0F4A3AE4C6865EC2E|yceE]-[gene|F16A11027D8D320D3D64E44038E29921A946955B|yceF]-[gene|F588108F12C5CA855A24159F28223EF67145D28F|yceG]-[gene|3A9EB32D5627FAB3F7646B7918E54C8D1ADD25DF|yceH]
description
[Pubmed|11866510]
regulation
induced by stress ([protein|search|SigB]) [Pubmed|11544224]
sigma factors
[protein|081DF3EE9FA56209D648C7677188C61CE3AA8E41|sigM]: sigma factor, [Pubmed|18179421], in [regulon|protein:081DF3EE9FA56209D648C7677188C61CE3AA8E41|sigM regulon]
[protein|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|sigW]: sigma factor, [Pubmed|11866510], in [regulon|protein:3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|sigW regulon]
[protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB]: sigma factor, [Pubmed|11544224,15805528], in [regulon|protein:580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB regulon]
[protein|E77364F274A520FCCA9F5C9504E317B047BA29E6|sigX]: sigma factor, [Pubmed|19047346], in [regulon|protein:E77364F274A520FCCA9F5C9504E317B047BA29E6|sigX regulon]
Open in new tab

[gene|7E4742F30B4C43FBF9DAE0B02948022AE7912A33|yceC]→[gene|3A9EB32D5627FAB3F7646B7918E54C8D1ADD25DF|yceH]

2021-11-18 10:45:44

ghost

4

1557da8d91643a69a9cc817172bc649767baab90

35ADA58FA11FB35C1D0420A579F4F2F0CD877167

Biological materials
Mutant
MGNA-B984 (yceD::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1983 NBRP B. subtilis, Japan]
BKE02900 (Δ[gene|DF30A8B195B8D830E131B23C768F07BE61F51150|yceD]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE02900 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGTTTCATCCACTCCTTT,  downstream forward: _UP4_TAAGACAAATACGAAGAGCA
BKK02900 (Δ[gene|DF30A8B195B8D830E131B23C768F07BE61F51150|yceD]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK02900 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGTTTCATCCACTCCTTT,  downstream forward: _UP4_TAAGACAAATACGAAGAGCA
References
15805528,18763711,11866510,18179421,19047346,21112337

DF30A8B195B8D830E131B23C768F07BE61F51150

Page visits: 1896

Time of last update: 2022-01-17 22:03:37

Author of last update: Melvin.boenninger