Register now for Subtillery 2022, the International Online Meeting on Bacillus subtilis! It will be held from the 19th-22th of September.


general stress protein, similar to tellurium resistance protein

Molecular weight
20.55 kDa
Protein length
Gene length
required for survival of ethanol stress

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG2310

This gene is a member of the following regulons

312,780 → 313,361
The protein
Protein family
CAPAB/TerDEXZ family (with [protein|7E4742F30B4C43FBF9DAE0B02948022AE7912A33|yceC] and [protein|863E26D497D29B820912A0C0F4A3AE4C6865EC2E|yceE], according to UniProt)
[PDB|2KXT] (from Klebsiella pneumoniae, 59% identity) [pubmed|21112337]
Paralogous protein(s)
[protein|7E4742F30B4C43FBF9DAE0B02948022AE7912A33|yceC], [protein|863E26D497D29B820912A0C0F4A3AE4C6865EC2E|yceE]
membrane associated [Pubmed|18763711]
Expression and Regulation
induced by stress ([protein|search|SigB]) [Pubmed|11544224]
sigma factors
[protein|081DF3EE9FA56209D648C7677188C61CE3AA8E41|sigM]: sigma factor, [Pubmed|18179421], in [regulon|protein:081DF3EE9FA56209D648C7677188C61CE3AA8E41|sigM regulon]
[protein|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|sigW]: sigma factor, [Pubmed|11866510], in [regulon|protein:3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|sigW regulon]
[protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB]: sigma factor, [Pubmed|11544224,15805528], in [regulon|protein:580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB regulon]
[protein|E77364F274A520FCCA9F5C9504E317B047BA29E6|sigX]: sigma factor, [Pubmed|19047346], in [regulon|protein:E77364F274A520FCCA9F5C9504E317B047BA29E6|sigX regulon]
Open in new tab


2022-08-03 02:10:35





Biological materials
MGNA-B984 (yceD::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1983 NBRP B. subtilis, Japan]
BKE02900 (Δ[gene|DF30A8B195B8D830E131B23C768F07BE61F51150|yceD]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE02900 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGTTTCATCCACTCCTTT,  downstream forward: _UP4_TAAGACAAATACGAAGAGCA
BKK02900 (Δ[gene|DF30A8B195B8D830E131B23C768F07BE61F51150|yceD]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK02900 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGTTTCATCCACTCCTTT,  downstream forward: _UP4_TAAGACAAATACGAAGAGCA


Page visits: 2355

Time of last update: 2022-08-07 08:09:55

Author of last update: Melvin.boenninger