mtrB

mtrB
168

tryptophan operon RNA-binding attenuation protein (TRAP), controls RNA switch in front of genes involved in biosynthesis and acquisition of tryptophan

locus
BSU_22770
Molecular weight
8.19 kDa
pI
7.33
Protein length
Gene length
function
regulation of tryptophan biosynthesis(and translation) attenuation in the trp operon;repression of the folate operon
product
tryptophan operon RNA-binding attenuation protein (TRAP)
essential
no
synonyms
mtrB

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms

This gene is a member of the following regulons

Gene
Coordinates
2,384,534 → 2,384,761
The protein
Protein family
MtrB family (single member, according to UniProt)
Structure
[PDB|3AQD],  [PDB|1WAP] (complex with L-tryptophan), [PDB|2ZP9] (complex with [protein|354C71C2F6AFE620866D90595E6AC6CEFA5705C3|rtpA])
[AF|P19466]
Effectors of protein activity
binding of tryptophan results RNA binding and thus in transcription termination
Expression and Regulation
Operons
genes
[gene|7732A37D59E2643F232F2C0AFE51BCF7A79EDE29|folE]-[gene|E030E80134E9DED6ADBC73C7C7435024CDFD38B9|mtrB]
description
[Pubmed|2123343]
regulation
constitutive [Pubmed|19767425]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|2123343], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|7732A37D59E2643F232F2C0AFE51BCF7A79EDE29|folE]→[gene|E030E80134E9DED6ADBC73C7C7435024CDFD38B9|mtrB]

2022-11-11 08:30:16

ghost

21

f1bc4bf9e927d1361809ff8aa78e71d66480a04b

86F7072792D249A1DF96784E3FA8EB41E1A5BB8F

Biological materials
Mutant
BKE22770 (Δ[gene|E030E80134E9DED6ADBC73C7C7435024CDFD38B9|mtrB]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE22770 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTTATAGCACCCTCTATC,  downstream forward: _UP4_TAAGCTGGCTGTCCCCGCTG
BKK22770 (Δ[gene|E030E80134E9DED6ADBC73C7C7435024CDFD38B9|mtrB]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK22770 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTTATAGCACCCTCTATC,  downstream forward: _UP4_TAAGCTGGCTGTCCCCGCTG
References
Reviews
19385727,16285852,15063849,31100987,32850966
Original Publications
22970197,19033375,17881743,10660627,10714985,12963367,14702295,16879415,17114058,17114263,11805104,7525975,10735881,15262953,14976255,8647825,18334255,10499579,7715723,8932308,11214184,15743934,7515880,9242649,7759487,15050822,14687568,9245598,9765233,11914485,15099736,7678334,8643393,15588817,16738132,1551827,17555767,7544009,11786553,11566976,2123343,11557884,12133840,16784236,10369778,7715723,10499579,11566976,7515880,21097886,21984911,24505391,24572018,24682818,25579595,27812824,28069823

E030E80134E9DED6ADBC73C7C7435024CDFD38B9

Page visits: 2439

Time of last update: 2022-11-27 08:41:24

Author of last update: Jstuelk