ybcC

ybcC
168

subunit of a Na+:bicarbonate transporter [protein|CCDDC414E266D86B9027EA67EA565D87357023B3|MpsA]-[protein|E04C67FB0EA3FFEC8FB68440F4661505C3DFDA29|MpsB]

locus
BSU_01845
Molecular weight
99.00 kDa
pI
5.731
Protein length
Gene length
function
uptake of bicarbonate
product
subunit of a Na+:bicarbonate transporter
essential
no
ec
null
synonyms
ybcC, mpsB

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG3002

This gene is a member of the following regulons

Gene
Coordinates
206,941 → 209,556
Phenotypes of a mutant
inactivation of [gene|E04C67FB0EA3FFEC8FB68440F4661505C3DFDA29|ybcC] facilitates the adaptation a strain lacking c-di-AMP to growth on medium containing glutamate [pubmed|33481774]
The protein
Catalyzed reaction/ biological activity
uptake of bicarbonate (with [protein|CCDDC414E266D86B9027EA67EA565D87357023B3|MpsA]) [pubmed|34287032]
Protein family
UPF0753 family (single member, according to UniProt)
Structure
[AF|O34688]
Expression and Regulation
Operons
genes
[gene|CCDDC414E266D86B9027EA67EA565D87357023B3|ndhF]-[gene|E04C67FB0EA3FFEC8FB68440F4661505C3DFDA29|ybcC]-[gene|5D96DF2F32050BBCEC3811843398FE84DE88F6DF|ybcF]-[gene|EBE0360D89E50EEBB84CC853C6E4B4053DBF8925|ybcH]-[gene|6E063903E9E3B770CAACA9DF98DFA540FAE6FD3D|ybcI]
description
[Pubmed|22383849]
Open in new tab

[gene|CCDDC414E266D86B9027EA67EA565D87357023B3|ndhF]→[gene|6E063903E9E3B770CAACA9DF98DFA540FAE6FD3D|ybcI]

2022-11-23 22:27:08

Jstuelk

37

e140e954b90890d3138431566447fb6e0403ad92

FF8650333154CD6783C7E2C33588F0F5E9F40953

Biological materials
Mutant
MGNA-C509 (ybcC::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2507 NBRP B. subtilis, Japan]
BKE01845 (Δ[gene|E04C67FB0EA3FFEC8FB68440F4661505C3DFDA29|ybcC]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE01845 BGSC] and in [wiki|Jörg Stülke]'s lab as GP3926,  [Pubmed|28189581], upstream reverse: _UP1_AATGCCCATCTCAGATTAGC,  downstream forward: _UP4_TAATGATGAATCTAAGCATT
BKK01845 (Δ[gene|E04C67FB0EA3FFEC8FB68440F4661505C3DFDA29|ybcC]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK01845 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_AATGCCCATCTCAGATTAGC,  downstream forward: _UP4_TAATGATGAATCTAAGCATT
Expression vectors
pGP2879: expression of Strep-''ybcC'' by [wiki|pGP380] in ''B. subtilis'' suitable for [wiki|SPINE], available in [wiki|Jörg Stülke]'s lab
Original Publications
33481774,25448817,31399577,34287032,34730408

E04C67FB0EA3FFEC8FB68440F4661505C3DFDA29

Page visits: 1442

Time of last update: 2022-11-28 05:07:24

Author of last update: Jstuelk