

bacterial hydrophobin, forms water-repellent surface layer of the biofilm, required for sliding, inhibitor of [protein|B29CAD04FB89ACC482EFCD29D50EDDA19145CAA2|kinA] autophosphorylation, and subsequently of entry into [wiki|sporulation]

Molecular weight
19.11 kDa
Protein length
Gene length
[wiki|biofilm formation], control of entry into [wiki|sporulation] via the [wiki|phosphorelay]
biofilm surface layer, inhibitor of [protein|B29CAD04FB89ACC482EFCD29D50EDDA19145CAA2|kinA] autophosphorylation
bslA, yuaB, sivB

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms

This gene is a member of the following regulons

3,187,503 → 3,188,048
Phenotypes of a mutant
reduced colony complexity [Pubmed|21742882]
loss of surface repellency of the biofilm [Pubmed|22571672]
diminished [wiki|sliding] of ''B. subtilis'' natto [Pubmed|26152584]
The protein
Catalyzed reaction/ biological activity
inhibits [protein|B29CAD04FB89ACC482EFCD29D50EDDA19145CAA2|kinA] autophophorylation [Pubmed|23335417]
contributes to the surface stiffness and increases the surface roughness of NCIB 3610 bioflms [Pubmed|26873313]
Protein family
BslA/BslB family (with [protein|E5E2994D96FCECEE75E15136A08308C7B6C1C183|sivA], according to UniProt)
[PDB|4BHU] [Pubmed|23904481]
Paralogous protein(s)
extracellular (signal peptide) [Pubmed|18957862]
biofilm matrix in an extracellular polysaccharide-dependent manner [Pubmed|22571672]
forms a layer on the biofilm surface [Pubmed|22571672]
Expression and Regulation
regulatory mechanism
[protein|E5110D9C36E8C55AFD1419987B14A53232165F20|abrB]: repression, [Pubmed|18978066], in [regulon|protein:E5110D9C36E8C55AFD1419987B14A53232165F20|abrB regulon]
[protein|E6F3BAC5875A16D8D75B2AD21447C14DD17B3DA6|lutR]: activation, [Pubmed|24196425], in [regulon|protein:E6F3BAC5875A16D8D75B2AD21447C14DD17B3DA6|lutR regulon]
[protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|degU]: activation, [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|degU]-P, [Pubmed|18978066], this might be indirect [Pubmed|21742882], in [regulon|protein:D343D2096664A972026D911E7A17A35C7B1CD1C9|degU regulon]
Open in new tab


2022-12-08 16:35:55





Biological materials
MGNA-A218 (yuaB::erm), available at the [ NBRP B. subtilis, Japan]
''B. subtilis'' W939 ''bslA''::Cm (ATCC6051 based) [Pubmed|17850253]
''B. subtilis'' NRS2097 ''bslA''::Cm (NCIB3610 based) [Pubmed|18978066]
''B. subtilis'' ''bslA''::Cm (168 based) [Pubmed|21097620]
BKE31080 (Δ[gene|E06A3392E644FEDC6F46ED41BBE89168F59B76B3|bslA]::erm  trpC2) available at [ BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATAACAAAATTCCCCCTAA,  downstream forward: _UP4_TAATGTAAAAGACCGGTTAA
BKK31080 (Δ[gene|E06A3392E644FEDC6F46ED41BBE89168F59B76B3|bslA]::kan  trpC2) available at [ BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATAACAAAATTCCCCCTAA,  downstream forward: _UP4_TAATGTAAAAGACCGGTTAA
Expression vectors
Physpank-bslA based on vector pDR111: pDRyuaB2 [Pubmed|21097620]
lacZ fusion
pNW500 P''bslA-lacZ'' fusion in pDG1663 [Pubmed|18978066]
GFP fusion
P''bslA-gfp'' fusion in pSG1151 vector: pSGyuaB [Pubmed|21097620]
Original Publications


Page visits: 9238

Time of last update: 2022-12-08 18:30:42

Author of last update: Jstuelk