rapB

rapB
168

response regulator aspartate phosphatase, dephosphorylates Spo0F-P, control of the phosphorelay

locus
BSU_36690
Molecular weight
44.88 kDa
pI
4.87
Protein length
Gene length
function
control of sporulation initiation
product
response regulator aspartate phosphatase
essential
no
synonyms
rapB, spo0P, ywmE

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms

This gene is a member of the following regulons

Gene
Coordinates
3,771,000 → 3,772,133
The protein
Protein family
[wiki|RAP family] (according to UniProt)
[wiki|Domains]
six [wiki|TPR repeat|tetratrichopeptide repeats] (according to UniProt)
Structure
[PDB|4I9E] ([protein|1F860F4E66A3D503D5A97F17D4AB0504BEFE7F9D|rapF], 43% identity) [pubmed|23526880]
[AF|P70962]
Expression and Regulation
Operons
genes
[gene|E07E123CC9FB3B29DDA8EC58A33FEEE1DDFC4834|rapB]
description
[Pubmed|9353933]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|11535782], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|E07E123CC9FB3B29DDA8EC58A33FEEE1DDFC4834|rapB]

2022-11-29 22:39:17

ghost

19

08393896efb7eae635258b5690024d559cec7094

6CA69680F9AE174D36BB5C52273FE9E960A811DC

Biological materials
Mutant
BKE36690 (Δ[gene|E07E123CC9FB3B29DDA8EC58A33FEEE1DDFC4834|rapB]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE36690 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGCCCCTCCAACCCTTTC,  downstream forward: _UP4_TGAGACAAAACCATCTGCTG
BKK36690 (Δ[gene|E07E123CC9FB3B29DDA8EC58A33FEEE1DDFC4834|rapB]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK36690 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGCCCCTCCAACCCTTTC,  downstream forward: _UP4_TGAGACAAAACCATCTGCTG
References
8643670,8730857,12067336,9843420,11535782,23526880

E07E123CC9FB3B29DDA8EC58A33FEEE1DDFC4834

Page visits: 2954

Time of last update: 2022-12-08 09:42:13

Author of last update: Melvin.boenninger