licR

licR
168

transcriptional activator of the [gene|65FC7F4ED92F747DB7BC5672DCA2D2320A471134|licB]-[gene|83A7C160B0301A2B51B65478D99ACB753D67AF74|licC]-[gene|E8B6C8E722BEE866878CDD816B7828C132F94FCD|licA]-[gene|84D8AA0AFBF46273F6B4198B49440D55470FEC0F|licH] operon

locus
BSU_38600
Molecular weight
73.14 kDa
pI
6.11
Protein length
Gene length
function
regulation of lichenan utilization
product
transcriptional activator, [wiki|PRD]-type
essential
no
ec
2.7.1.69
synonyms
licR, celR

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG3711

This gene is a member of the following regulons

Gene
Coordinates
3,962,003 → 3,963,928
The protein
Protein family
[wiki|PRD-containing transcription factors]
[wiki|Domains]
2 [wiki|PRD] domains (aa 184-289, aa 296-403)
[wiki|PTS EIIB domain] type-2 (aa 407-498)
[wiki|PTS EIIA domain] type-2 (aa 499-638)
Structure
[AF|P46321]
Modification
phosphorylation (His219, His278, His333, His392, Cys413, His559) (according to Swiss-Prot)
Expression and Regulation
Operons
genes
[gene|E087ABA705CE94E2CAD44A0F2FB265B0F7B04399|licR]
description
[Pubmed|8990303]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|8990303], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|E087ABA705CE94E2CAD44A0F2FB265B0F7B04399|licR]

2022-11-26 03:54:50

ghost

24

d5c10ad343c980faac629b1d1f6976efe1029338

E6126F116E19941A13BA7F262EBCEBF2D41CD477

Biological materials
Mutant
BKE38600 (Δ[gene|E087ABA705CE94E2CAD44A0F2FB265B0F7B04399|licR]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE38600 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGAGAAAAACCTCCTAAC,  downstream forward: _UP4_TGACAGCCTGTATATACCTT
BKK38600 (Δ[gene|E087ABA705CE94E2CAD44A0F2FB265B0F7B04399|licR]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK38600 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGAGAAAAACCTCCTAAC,  downstream forward: _UP4_TGACAGCCTGTATATACCTT
References
8990303,10438772

E087ABA705CE94E2CAD44A0F2FB265B0F7B04399

Page visits: 1865

Time of last update: 2022-11-26 12:37:28

Author of last update: Melvin.boenninger