yrkR

yrkR
168

unknown

locus
BSU_26410
Molecular weight
16.38 kDa
pI
8.82
Protein length
Gene length
function
unknown
product
unknown
essential
no
synonyms
yrkR

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG3223

This gene is a member of the following regulons

Gene
Coordinates
2,702,688 → 2,703,104
The protein
Protein family
psiE family (single member, according to UniProt)
Structure
[AF|P54445]
[wiki|Localization]
cell membrane (according to UniProt)
Expression and Regulation
Operons
genes
[gene|1582F9E6510C4FA87B3A5F3F4A7F39008C654AA9|yrkP]-[gene|8A38FEFAA0FF91D989B77D40CBB3741902DC9D67|yrkQ]-[gene|E0DF6DE230AD0B632EEC0A1FB11EB32E59BD573E|yrkR]
description
[Pubmed|18175906]
regulatory mechanism
[protein|1582F9E6510C4FA87B3A5F3F4A7F39008C654AA9|yrkP]: activation, [Pubmed|18175906], in [regulon|protein:1582F9E6510C4FA87B3A5F3F4A7F39008C654AA9|yrkP regulon]
Open in new tab

[gene|1582F9E6510C4FA87B3A5F3F4A7F39008C654AA9|yrkP]→[gene|E0DF6DE230AD0B632EEC0A1FB11EB32E59BD573E|yrkR]

2022-11-28 19:16:54

ghost

14

e3d063de09cd9c4d97c8ec82b566de3adad28a57

9CC2987CFD31A5505E51ACD9A4B0D933B757785A

Biological materials
Mutant
MGNA-C503 (yrkR::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2501 NBRP B. subtilis, Japan]
BKE26410 (Δ[gene|E0DF6DE230AD0B632EEC0A1FB11EB32E59BD573E|yrkR]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE26410 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCATGTTGTCTCCTATTT,  downstream forward: _UP4_TAATAAATTAGTTCGCATTA
BKK26410 (Δ[gene|E0DF6DE230AD0B632EEC0A1FB11EB32E59BD573E|yrkR]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK26410 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCATGTTGTCTCCTATTT,  downstream forward: _UP4_TAATAAATTAGTTCGCATTA
References
18175906

E0DF6DE230AD0B632EEC0A1FB11EB32E59BD573E

Page visits: 901

Time of last update: 2022-11-26 08:26:09

Author of last update: Melvin.boenninger