rapG

rapG
168

response regulator aspartate phosphatase, controls [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|degU] activity

locus
BSU_40300
Molecular weight
42.68 kDa
pI
4.81
Protein length
Gene length
function
control of [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|degU] activity
product
response regulator aspartate phosphatase
essential
no
synonyms
rapG, yycM

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms

This gene is a member of the following regulons

Gene
Coordinates
4,140,260 → 4,141,357
The protein
Catalyzed reaction/ biological activity
control of [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|degU] activity [Pubmed|12950930]
Protein family
[wiki|RAP family] (according to UniProt)
[wiki|Domains]
six [wiki|TPR repeat|tetratrichopeptide repeats] (according to UniProt)
Structure
[PDB|4I9E] ([protein|1F860F4E66A3D503D5A97F17D4AB0504BEFE7F9D|rapF], 26% identity) [pubmed|23526880]
[AF|O32294]
Effectors of protein activity
binding of [protein|3B4E60C698B8E4FA286E06B934EC0CEDD5F516A5|phrG] to [protein|E1744329B6489F989F93F3E71E51E772E3926ABF|rapG] prevents it from binding [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|degU] [Pubmed|12950930]
Expression and Regulation
Operons
genes
[gene|E1744329B6489F989F93F3E71E51E772E3926ABF|rapG]-[gene|3B4E60C698B8E4FA286E06B934EC0CEDD5F516A5|phrG]
description
[Pubmed|12950930]
regulation
repressed by glucose (4.8-fold) ([protein|search|CcpA]) [Pubmed|12850135]
regulatory mechanism
[protein|5A6FBAE6553343092862CB79E150F934978C32A9|sinR]: repression, [Pubmed|16430695], in [regulon|protein:5A6FBAE6553343092862CB79E150F934978C32A9|sinR regulon]
[protein|972401B6AF56EC67FE6F1C3FEA9E2A9FC77C7672|rghR]: repression, [Pubmed|16553878], in [regulon|protein:972401B6AF56EC67FE6F1C3FEA9E2A9FC77C7672|rghR regulon]
[protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA]: repression, [Pubmed|12850135], in [regulon|protein:E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|16553878], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
[protein|DC3449D5F195E5C2E9E14FEC95396C8F1FDF73B4|sigH]: sigma factor, [Pubmed|12950930], in [regulon|protein:DC3449D5F195E5C2E9E14FEC95396C8F1FDF73B4|sigH regulon]
Open in new tab

[gene|E1744329B6489F989F93F3E71E51E772E3926ABF|rapG]→[gene|3B4E60C698B8E4FA286E06B934EC0CEDD5F516A5|phrG]

2022-11-26 18:54:59

ghost

36

e49c87eec067b5c485c5a9eb9803177ba906bdbf

B07F03B9D46149465A5E6BF2E71700DEE720BCBE

Biological materials
Mutant
MGNA-B821 (yycM::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1820 NBRP B. subtilis, Japan]
BKE40300 (Δ[gene|E1744329B6489F989F93F3E71E51E772E3926ABF|rapG]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE40300 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGTGAAACTCCTTTCTCT,  downstream forward: _UP4_ATTAAACGAACGGAGGTTAT
BKK40300 (Δ[gene|E1744329B6489F989F93F3E71E51E772E3926ABF|rapG]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK40300 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGTGAAACTCCTTTCTCT,  downstream forward: _UP4_ATTAAACGAACGGAGGTTAT
References
16553878,16430695,12950930,23526880

E1744329B6489F989F93F3E71E51E772E3926ABF

Page visits: 3777

Time of last update: 2022-12-08 09:38:19

Author of last update: Melvin.boenninger