ycxB

ycxB
168

unknown

locus
BSU_03540
Molecular weight
21.89 kDa
pI
9.68
Protein length
Gene length
function
unknown
product
unknown
essential
no
ec
null
synonyms
ycxB

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms

This gene is a member of the following regulons

Gene
Coordinates
404,458 → 405,015
The protein
Structure
[AF|Q08793]
[wiki|Localization]
cell membrane (according to UniProt)
Expression and Regulation
Operons
genes
[gene|20AE0AE853AD334D4CC8E3D6466BD282E1A2074E|ycxC]-[gene|E17BB82EB15EFB221C6672A44E71DBEFC5D19B3E|ycxB]
description
[pubmed|22383849]
Open in new tab

[gene|20AE0AE853AD334D4CC8E3D6466BD282E1A2074E|ycxC]→[gene|E17BB82EB15EFB221C6672A44E71DBEFC5D19B3E|ycxB]

2022-11-22 18:22:04

Jstuelk

18

858fa54cea02815cbf2bdbe51b0060b26c15b84e

1913E4BCD72D997105649FCADDA8538BA35533D5

genes
[gene|E17BB82EB15EFB221C6672A44E71DBEFC5D19B3E|ycxB]
description
[pubmed|22383849]
Open in new tab

[gene|E17BB82EB15EFB221C6672A44E71DBEFC5D19B3E|ycxB]

2022-11-25 10:22:39

Jstuelk

11

14a76727fbc1d443aea478546e04699e27737852

8D2663961A988F2671151ADA929F74BC280353A6

Biological materials
Mutant
MGNA-C058 (ycxB::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2056 NBRP B. subtilis, Japan]
BKE03540 (Δ[gene|E17BB82EB15EFB221C6672A44E71DBEFC5D19B3E|ycxB]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE03540 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATACGGTAAACCTACACCT,  downstream forward: _UP4_CAGCATTGACAGTGCTGATC
BKK03540 (Δ[gene|E17BB82EB15EFB221C6672A44E71DBEFC5D19B3E|ycxB]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK03540 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATACGGTAAACCTACACCT,  downstream forward: _UP4_CAGCATTGACAGTGCTGATC

E17BB82EB15EFB221C6672A44E71DBEFC5D19B3E

Page visits: 1180

Time of last update: 2022-11-30 17:36:21

Author of last update: Melvin.boenninger