ybxI

ybxI
168

beta-lactamase

locus
BSU_02090
Molecular weight
30.49 kDa
pI
6.84
Protein length
Gene length
function
unknown
product
beta-lactamase
essential
no
ec
3.5.2.6
synonyms
ybxI, ybdS

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG2602

This gene is a member of the following regulons

Gene
Coordinates
228,549 → 229,352
The protein
Catalyzed reaction/ biological activity
β-lactam + H2O --> substituted β-amino acid (according to UniProt)
Protein family
[wiki|beta-lactamase family] (according to UniProt)
class-D beta-lactamase family (single member, according to UniProt)
Structure
[PDB|5E2F]
[AF|P54427]
[wiki|Localization]
extracellular (signal peptide) [Pubmed|18957862]
Expression and Regulation
Operons
genes
[gene|E1CBB22683967FA47CB5886755BC3C3BFE6CC499|ybxI]
description
[Pubmed|22383849]
Open in new tab

[gene|E1CBB22683967FA47CB5886755BC3C3BFE6CC499|ybxI]

2022-12-01 17:51:48

ghost

8

7ab504e73632dc45b9d914efc324419d1536153e

BBCF8CDFA4EB2149ADC4831654A40EEBA759A5C3

Biological materials
Mutant
MGNA-B962 (ybxI::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1961 NBRP B. subtilis, Japan]
BKE02090 (Δ[gene|E1CBB22683967FA47CB5886755BC3C3BFE6CC499|ybxI]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE02090 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTTTGTTCTCCCCTTCGT,  downstream forward: _UP4_TAAATAAAAGAGCCCTGCAC
BKK02090 (Δ[gene|E1CBB22683967FA47CB5886755BC3C3BFE6CC499|ybxI]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK02090 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTTTGTTCTCCCCTTCGT,  downstream forward: _UP4_TAAATAAAAGAGCCCTGCAC
References
18957862,26551395

E1CBB22683967FA47CB5886755BC3C3BFE6CC499

Page visits: 878

Time of last update: 2022-12-01 00:17:57

Author of last update: Melvin.boenninger