yerA
Register now for Subtillery 2022, the International Online Meeting on Bacillus subtilis! It will be held from the 19th-22th of September.

yerA
168

N6-methyladenosine deaminase

locus
BSU_06560
Molecular weight
66.47 kDa
pI
5.82
Protein length
Gene length
function
utilization of N6-methyladenosine
product
N6-methyladenosine deaminase
essential
no
ec
3.5.4.2
synonyms
yerA

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1001

This gene is a member of the following regulons

Gene
Coordinates
713,664 → 715,406
The protein
Catalyzed reaction/ biological activity
deamination of N6-methyladenosine [pubmed|34850126]
Protein family
[wiki|Metallo-dependent hydrolases superfamily] (according to UniProt)
[wiki|Cofactors]
Mn2+ [pubmed|34850126]
Structure
[AF|O34909]
Modification
phosphorylation on Ser-399 [Pubmed|17218307]
Expression and Regulation
Operons
genes
[gene|E20A5429BCD8719A403229AFB200225EA14EE2DB|yerA]-[gene|BE1F7BA77CE8B6A1A2D22F31421C27F2E954816A|yerB]-[gene|B948BD67148DC53B371E6748347982067CE28C36|yerC]
description
[pubmed|22383849]
Open in new tab

[gene|E20A5429BCD8719A403229AFB200225EA14EE2DB|yerA]->[gene|B948BD67148DC53B371E6748347982067CE28C36|yerC]

2022-06-03 10:22:23

Jstuelk

25

27118e8ac25de79a5f16b7c892f0bef97db8a276

FB076D59B31BC86C730E1BA088BDB513FF318277

Biological materials
Mutant
MGNA-A910 (yerA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/910 NBRP B. subtilis, Japan]
BKE06560 (Δ[gene|E20A5429BCD8719A403229AFB200225EA14EE2DB|yerA]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE06560 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTCACATACTCTCCTTTA,  downstream forward: _UP4_TAAAATATAAAAGAGCAGGG
BKK06560 (Δ[gene|E20A5429BCD8719A403229AFB200225EA14EE2DB|yerA]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK06560 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTCACATACTCTCCTTTA,  downstream forward: _UP4_TAAAATATAAAAGAGCAGGG
References
17218307,34850126

E20A5429BCD8719A403229AFB200225EA14EE2DB

Page visits: 1046

Time of last update: 2022-08-04 00:07:50

Author of last update: Jstuelk