

general stress protein, survival of ethanol stress and low temperatures

Molecular weight
16.42 kDa
Protein length
Gene length
survival of ethanol stress and low temperatures

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG4876

This gene is a member of the following regulons

492,989 → 493,441
The protein
Expression and Regulation
induced by stress ([protein|search|SigB]) [Pubmed|15805528]
sigma factors
[protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB]: sigma factor, [Pubmed|10482513], in [regulon|protein:580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB regulon]
Open in new tab


2022-11-23 14:32:22





Biological materials
MGNA-C091 (ydaT::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2089 NBRP B. subtilis, Japan]
BKE04380 (Δ[gene|E30C92E8D0CC56F7406B87B7EA25B7C41086DD73|ydaT]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE04380 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGTCTATCACTCCTTTTC,  downstream forward: _UP4_TAAAGGAATATGCTTTCAAG
BKK04380 (Δ[gene|E30C92E8D0CC56F7406B87B7EA25B7C41086DD73|ydaT]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK04380 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGTCTATCACTCCTTTTC,  downstream forward: _UP4_TAAAGGAATATGCTTTCAAG


Page visits: 956

Time of last update: 2022-12-04 15:22:47

Author of last update: Bzhu