glnT

glnT
168

glutamine transporter (proton symport)

locus
BSU_02420
Molecular weight
49.83 kDa
pI
10.13
Protein length
Gene length
function
glutamine uptake
product
glutamine transporter (proton symport)
essential
no
synonyms
glnT, ybgH

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1115

This gene is a member of the following regulons

Gene
Coordinates
262,732 → 264,168
The protein
Protein family
[wiki|Alanine or glycine:cation symporter (AGCS) (TC 2.A.25) family] (according to UniProt)
Structure
[PDB|6CSE] (from Methanococcus maripaludis), 37.4% identity [pubmed|30659158]
[AF|O31464]
Paralogous protein(s)
[protein|B84BE9F5BEFE3A295ED5580D66040CD28609A6A1|alsT], [protein|A69E7536DFE6353C4CD1B09D1258C88BF0FB8B4D|yflA], [protein|A10EA56A7EDA2DF712B5BB87D94A818E39940B44|yrbD]
[wiki|Localization]
cell membrane (according to UniProt)
Expression and Regulation
Operons
genes
[gene|1A415DC85354373EA4866733C3AE43F510BD3C56|glsA]-[gene|E371BC4F613C40CB0E8C8CAA97387F3E6735D813|glnT]
description
[Pubmed|15995196]
regulation
induced in the presence of glutamine ([protein|search|GlnL]) [Pubmed|15995196]
regulatory mechanism
[protein|4E6EA2EABBDAA427E8F9EE1AE1800AF8657CF18B|glnL]: activation, [Pubmed|15995196], in [regulon|protein:4E6EA2EABBDAA427E8F9EE1AE1800AF8657CF18B|glnL regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|15995196], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|1A415DC85354373EA4866733C3AE43F510BD3C56|glsA]→[gene|E371BC4F613C40CB0E8C8CAA97387F3E6735D813|glnT]

2022-11-24 20:29:44

ghost

26

1abc9708789b9480434727fa47a0c483a7d39864

AA0FCFADA92CADCC16FD2BF6A3187BADD37324D7

Biological materials
Mutant
GP3503 (Δ[gene|E371BC4F613C40CB0E8C8CAA97387F3E6735D813|glnT]::kan), available in [wiki|Jörg Stülke]'s lab
MGNA-B942 ([gene|E371BC4F613C40CB0E8C8CAA97387F3E6735D813|glnT]::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1941 NBRP B. subtilis, Japan]
BKE02420 (Δ[gene|E371BC4F613C40CB0E8C8CAA97387F3E6735D813|glnT]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE02420 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATAGAATCACCTCTTTTTT,  downstream forward: _UP4_TAAGAAAAGGGTGTTCAGAC
BKK02420 (Δ[gene|E371BC4F613C40CB0E8C8CAA97387F3E6735D813|glnT]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK02420 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATAGAATCACCTCTTTTTT,  downstream forward: _UP4_TAAGAAAAGGGTGTTCAGAC
References
15995196,30659158

E371BC4F613C40CB0E8C8CAA97387F3E6735D813

Page visits: 1848

Time of last update: 2022-11-28 22:00:18

Author of last update: Jstuelk