ppsA

ppsA
168

plipastatin synthetase

locus
BSU_18340
Molecular weight
288.86 kDa
pI
5.22
Protein length
Gene length
function
production of the antibacterial compound plipastatin
product
plipastatin synthetase
essential
no
synonyms
ppsA

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG4908

This gene is a member of the following regulons

Gene
Coordinates
1,990,272 → 1,997,957
The protein
Protein family
[wiki|ATP-dependent AMP-binding enzyme family] (according to UniProt)
[wiki|Domains]
2 [wiki|Carrier domain]s (aa 961-1036, aa 2007-2081) (according to UniProt)
Structure
[PDB|2VSQ] (termination module of [protein|1D5F227860A321506A1AB4BAE63CAD3A66E43BFC|srfAC], 30% identity) [pubmed|18583577]
[AF|P39845]
Expression and Regulation
Operons
genes
[gene|E3D7EF8F165CAC2682B0D620081C5C6E555E43C4|ppsA]-[gene|E7A2F93B33B1899313893D362D92405232BC9097|ppsB]-[gene|D11CE89E2AC2ADE3FEFEC261E295EC5906CE6407|ppsC]-[gene|E73D9F1A8F54DAD4B2056CABBE580D7AD36CB042|ppsD]-[gene|C1C051209943E02369356075EAA733297E9478CB|ppsE]
description
[Pubmed|20817675]
regulatory mechanism
[protein|E5110D9C36E8C55AFD1419987B14A53232165F20|abrB]: repression, [Pubmed|20817675], in [regulon|protein:E5110D9C36E8C55AFD1419987B14A53232165F20|abrB regulon]
Open in new tab

[gene|E3D7EF8F165CAC2682B0D620081C5C6E555E43C4|ppsA]→[gene|C1C051209943E02369356075EAA733297E9478CB|ppsE]

2022-11-24 21:58:46

ghost

22

c24e95905169206a2bb4f32c2e44eb72392e19bb

53EB981BAF3A634ABF820E4DAD645D458FD52A47

Biological materials
Mutant
BKE18340 (Δ[gene|E3D7EF8F165CAC2682B0D620081C5C6E555E43C4|ppsA]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE18340 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAACGGATTCCCTCCAGTTC,  downstream forward: _UP4_TAACTTTTGAAAAGGTGTGT
BKK18340 (Δ[gene|E3D7EF8F165CAC2682B0D620081C5C6E555E43C4|ppsA]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK18340 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAACGGATTCCCTCCAGTTC,  downstream forward: _UP4_TAACTTTTGAAAAGGTGTGT
References
10471562,9387222,20817675,18583577,34460312

E3D7EF8F165CAC2682B0D620081C5C6E555E43C4

Page visits: 3144

Time of last update: 2022-11-28 22:33:03

Author of last update: Jstuelk