pgi
Register now for Subtillery 2022, the International Online Meeting on Bacillus subtilis! It will be held from the 19th-22th of September.

pgi
168

glucose 6-phosphate isomerase, glycolytic / gluconeogenic enzyme

locus
BSU_31350
Molecular weight
50.36 kDa
pI
4.85
Protein length
Gene length
function
enzyme in glycolysis / gluconeogenesis
product
glucose-6-phosphate isomerase
essential
no
ec
5.3.1.9
synonyms
pgi, yugL

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0166

This gene is a member of the following regulons

Gene
Coordinates
3,220,731 3,222,083
Phenotypes of a mutant
poorly transformable [pubmed|28189581]
a [gene|43CD2581DA421CABC66E30389640CC86E6B2D800|zwf] [gene|E3DAC5DE86EE0E34C6ECB6DE1E41309742465CF9|pgi] double mutant is unable to grow on minimal medium in the presence of glucose (due to the accumulation of toxic glucose-1-phosphate) [pubmed|4275311]
a [gene|43CD2581DA421CABC66E30389640CC86E6B2D800|zwf] [gene|E3DAC5DE86EE0E34C6ECB6DE1E41309742465CF9|pgi] [gene|70412A747D1ED3E885126945DF02503667C13E5B|pgcA] triple mutant is not viable [pubmed|30782637]
The protein
Catalyzed reaction/ biological activity
aldehydo-D-glucose 6-phosphate --> keto-D-fructose 6-phosphate (according to UniProt)
Protein family
GPI family (single member, according to UniProt)
Structure
[PDB|1B0Z] (''Geobacillus stearothermophilus''), [http://www.proteopedia.org/wiki/index.php/2pgi 2PGI] (''Geobacillus stearothermophilus'')
[AF|P80860]
Modification
phosphorylation on Thr-39 [Pubmed|17218307]
phosphorylated on Arg-5 [Pubmed|31221751]
Effectors of protein activity
competitively inhibited by 6-phosphogluconate (in ''B.caldotenax, B.stearothermophilus'') [Pubmed|7400125]
[wiki|Localization]
cytoplasm (homogeneously distributed throughout the cell) [Pubmed|24825009]
Additional information
extensive information on the structure and enzymatic properties of Pgi can be found at [http://www.proteopedia.org/wiki/index.php/Phosphoglucose_isomerase Proteopedia]
belongs to the 100 most abundant proteins [PubMed|15378759]
Expression and Regulation
Operons
genes
[gene|E3DAC5DE86EE0E34C6ECB6DE1E41309742465CF9|pgi]-[gene|BD63E58F9CF99F9A1888099F3393B30DE3F164F5|yugM]-[gene|0C8E5DFD40F4B2EB540199DFB2520E3FBC878530|yugN]
description
[Pubmed|11489127]
regulation
constitutively expressed [Pubmed|11489127]
Open in new tab

[gene|E3DAC5DE86EE0E34C6ECB6DE1E41309742465CF9|pgi]→[gene|0C8E5DFD40F4B2EB540199DFB2520E3FBC878530|yugN]

2022-07-10 06:44:48

ghost

19

aea70d5253c79b98d56a32d7b8d16048ad6e6fb7

8E597C166D57BC7003E745D5E0D4772E89D7C363

Biological materials
Mutant
GP508 (spc), available in [wiki|Jrg Stlke]'s lab, [Pubmed|23420519]
GP1746: BSB1 ''pgi::aphA3'', available in [wiki|Jrg Stlke]' lab
BKE31350 ([gene|E3DAC5DE86EE0E34C6ECB6DE1E41309742465CF9|pgi]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE31350 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGCTTGTCCCTCCATAA, downstream forward: _UP4_TAATGTGAGAAAGCTGACTG
BKK31350 ([gene|E3DAC5DE86EE0E34C6ECB6DE1E41309742465CF9|pgi]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK31350 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGCTTGTCCCTCCATAA, downstream forward: _UP4_TAATGTGAGAAAGCTGACTG
Expression vectors
pGP398 (N-terminal His-tag, in [wiki|pWH844]), available in [wiki|Jrg Stlke]'s lab
two-hybrid system
B. pertussis adenylate cyclase-based bacterial two hybrid system ([wiki|BACTH]), available in [wiki|Jrg Stlke]'s lab, [pubmed|19193632]
lacZ fusion
pGP510 (in [wiki|pAC6]), available in [wiki|Jrg Stlke]'s lab
labs
[wiki|Jörg Stülke], University of Göttingen, Germany [http://wwwuser.gwdg.de/~genmibio/stuelke.html homepage]
References
**Reviews
34585982
Original Publications
17218307,19052382,4214896,23420519,11489127,4275311,11491085,17218307,24571712,15378759,24825009,28189581,31221751,30782637,4275311

E3DAC5DE86EE0E34C6ECB6DE1E41309742465CF9

Page visits: 3174

Time of last update: 2022-08-09 04:38:28

Author of last update: Jstuelk