ydbS

ydbS
168

resistence against antimicrobial compounds from B. amyloliquefaciens

locus
BSU_04590
Molecular weight
17.98 kDa
pI
8.13
Protein length
Gene length
function
confers resistence against antimicrobial compounds from B. amyloliquefaciens
product
unknown
essential
no
ec
null
synonyms
ydbS

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG3402

This gene is a member of the following regulons

Gene
Coordinates
512,814 → 513,293
The protein
Protein family
UPF0699 family (with [protein|15CD9023540E3BB7D3EC8A60E204052DD256CE9F|ydbT], according to UniProt)
Structure
[AF|P96615]
[wiki|Localization]
cell membrane (according to UniProt)
Expression and Regulation
Operons
genes
[gene|E4139214AB491712309F84A0792BCD8939F634D7|ydbS]-[gene|15CD9023540E3BB7D3EC8A60E204052DD256CE9F|ydbT]
description
[Pubmed|11866510]
sigma factors
[protein|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|sigW]: sigma factor, [Pubmed|12207695], in [regulon|protein:3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|sigW regulon]
Open in new tab

[gene|E4139214AB491712309F84A0792BCD8939F634D7|ydbS]→[gene|15CD9023540E3BB7D3EC8A60E204052DD256CE9F|ydbT]

2022-11-21 09:01:29

ghost

16

687bcf606d3cd5a448ab026ec70f901160db5f87

F60B1757D84E3B8F40084D5EEE2410BE14586A6E

Biological materials
Mutant
MGNA-C100 (ydbS::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2098 NBRP B. subtilis, Japan]
BKE04590 (Δ[gene|E4139214AB491712309F84A0792BCD8939F634D7|ydbS]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE04590 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAAAAATACCTACCTCCCTT,  downstream forward: _UP4_TCCCGTCTGGCGAGGGTGAC
BKK04590 (Δ[gene|E4139214AB491712309F84A0792BCD8939F634D7|ydbS]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK04590 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAAAAATACCTACCTCCCTT,  downstream forward: _UP4_TCCCGTCTGGCGAGGGTGAC
References
16629676,12207695,11866510

E4139214AB491712309F84A0792BCD8939F634D7

Page visits: 1440

Time of last update: 2022-11-26 10:54:16

Author of last update: Melvin.boenninger