ywnJ

ywnJ
168

unknown

locus
BSU_36540
Molecular weight
15.93 kDa
pI
8.44
Protein length
Gene length
function
unknown
product
unknown
essential
no
ec
null
synonyms
ywnJ

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms

This gene is a member of the following regulons

Gene
Coordinates
3,759,169 → 3,759,591
The protein
Structure
[AF|P71045]
[wiki|Localization]
cell membrane (according to UniProt)
Expression and Regulation
Operons
genes
[gene|E44811DF107D3761550E68F270E29B9E465D434D|ywnJ]
description
[Pubmed|12399481]
regulation
expressed during sporulation in the forespore ([protein|search|SigF]) [Pubmed|16497325,15699190]
sigma factors
[protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|sigF]: sigma factor, [Pubmed|16497325], in [regulon|protein:CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|sigF regulon]
[protein|081DF3EE9FA56209D648C7677188C61CE3AA8E41|sigM]: sigma factor, [Pubmed|18179421], in [regulon|protein:081DF3EE9FA56209D648C7677188C61CE3AA8E41|sigM regulon]
[protein|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|sigW]: sigma factor, [Pubmed|14762009], in [regulon|protein:3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|sigW regulon]
[protein|E77364F274A520FCCA9F5C9504E317B047BA29E6|sigX]: sigma factor, [Pubmed|14762009], in [regulon|protein:E77364F274A520FCCA9F5C9504E317B047BA29E6|sigX regulon]
Open in new tab

[gene|E44811DF107D3761550E68F270E29B9E465D434D|ywnJ]

2022-03-09 23:44:58

ghost

6

e64bc833e796c2631558c33d18c5416ffc980a4d

68F7C836493DD11339E1AF3498178E4D27DA448F

Biological materials
Mutant
MGNA-A210 (ywnJ::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/210 NBRP B. subtilis, Japan]
BKE36540 (Δ[gene|E44811DF107D3761550E68F270E29B9E465D434D|ywnJ]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE36540 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGACATAACCTCCTTTAT,  downstream forward: _UP4_TAAAGCCGGCTGTCTTGATT
BKK36540 (Δ[gene|E44811DF107D3761550E68F270E29B9E465D434D|ywnJ]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK36540 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGACATAACCTCCTTTAT,  downstream forward: _UP4_TAAAGCCGGCTGTCTTGATT
References
14762009,16497325,12399481,18179421

E44811DF107D3761550E68F270E29B9E465D434D

Page visits: 1514

Time of last update: 2022-06-25 13:37:54

Author of last update: Melvin.boenninger