ycgB

ycgB
168

unknown

locus
BSU_03030
Molecular weight
22.11 kDa
pI
10.7
Protein length
Gene length
function
unknown
product
unknown
essential
no
ec
null
synonyms
ycgB

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms

This gene is a member of the following regulons

Gene
Coordinates
326,888 → 327,469
The protein
Structure
[AF|P55909]
Expression and Regulation
Operons
genes
[gene|E48DE0C73CB859E2B367B6800E85BD94836390A5|ycgB]-[gene|DE4857E8A228F145EFB9B7AD817585258344ED1F|amyE]
description
[Pubmed|22383849]
Open in new tab

[gene|E48DE0C73CB859E2B367B6800E85BD94836390A5|ycgB]→[gene|DE4857E8A228F145EFB9B7AD817585258344ED1F|amyE]

2022-11-28 13:26:57

Jstuelk

28

4d73540d58e9160378cbe1d6172da0e4c3b96a47

AEAD67D53BF62123E4AEE8F1A51527D216CC81E4

Biological materials
Mutant
BKE03030 (Δ[gene|E48DE0C73CB859E2B367B6800E85BD94836390A5|ycgB]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE03030 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGACCTTCCTCCCGCACT,  downstream forward: _UP4_TGATAGAGTGATTGTGATAA
BKK03030 (Δ[gene|E48DE0C73CB859E2B367B6800E85BD94836390A5|ycgB]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK03030 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGACCTTCCTCCCGCACT,  downstream forward: _UP4_TGATAGAGTGATTGTGATAA

E48DE0C73CB859E2B367B6800E85BD94836390A5

Page visits: 1095

Time of last update: 2022-11-30 11:42:44

Author of last update: Bzhu