abrB

abrB
168

transcriptional regulator of transition state genes

locus
BSU_00370
Molecular weight
10.63 kDa
pI
6.57
Protein length
Gene length
function
regulation of gene expression during the transition from growth to stationary phase
product
transcriptional regulator
essential
no
synonyms
abrB, cpsX, tolB

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG2002

This gene is a member of the following regulons

Gene
Coordinates
44,848 → 45,138
Phenotypes of a mutant
No swarming motility on B medium [Pubmed|19202088]
The protein
[wiki|Domains]
[wiki|SpoVT-AbrB domain] (aa 7-52) (according to UniProt)
Structure
[PDB|2MJG] (full-length protein) [Pubmed|25308864]
[PDB|1Z0R] (N-terminal DNA recognition domain) [Pubmed|16223496]
[AF|P08874]
Modification
phosphorylated on Ser-86 [Pubmed|20509597] by [protein|23FF4A00C36EC1B7297F51A9EF3579B41F0B7EBA|prkC], [protein|E0097A00C82136BB0B1FB89FBA177E28A4EC3D54|prkD], and [protein|E86A96B832351FF513DD9853EAD8998CC44C9951|yabT] results in loss of DNA-binding activity [Pubmed|24731262]
Effectors of protein activity
interaction with [protein|899FF5BEE5D3F01778A0175E293EDBBDEB25717D|abbA] results in inactivation of AbrB [Pubmed|18840696]
Paralogous protein(s)
[protein|01EF886D3D004EA9B22AC5E75D50FF07D8631E68|spoVT], [protein|5872812AB61E92E2944E926915EB7FEE71BFA6D5|abh]
Expression and Regulation
Operons
genes
[gene|E5110D9C36E8C55AFD1419987B14A53232165F20|abrB]
description
[Pubmed|3145384]
regulation
expressed at the onset of stationary phase [Pubmed|3145384]
regulatory mechanism
[protein|2C54FE2ADC82FF414D732018C90649D477A925AD|spo0A]: repression, -P [Pubmed|3145384], in [regulon|protein:2C54FE2ADC82FF414D732018C90649D477A925AD|spo0A regulon]
[protein|E5110D9C36E8C55AFD1419987B14A53232165F20|abrB]: repression, [Pubmed|2504584], in [regulon|protein:E5110D9C36E8C55AFD1419987B14A53232165F20|abrB regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|3145384], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
additional information
degradation of the ''[wiki|abrB]'' mRNA is triggered by base-pairing with [wiki|RnaC] [Pubmed|25790031]
Open in new tab

[gene|E5110D9C36E8C55AFD1419987B14A53232165F20|abrB]

2022-12-01 18:50:37

ghost

44

65f112afac8637a86c400c198f88bcfd98eb2938

29CADBB12EED79873A2D269725A6A283680F56A3

Biological materials
Mutant
TT731 (aphA3)
1A935 (''abrB''::''cat''), [Pubmed|11886552], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A935&Search=1A935 BGSC]
GP1548 (''abrB''::''ermC''), available in [wiki|Stülke] lab
BKE00370 (Δ[gene|E5110D9C36E8C55AFD1419987B14A53232165F20|abrB]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE00370 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTCTCCTCCCAAGAGATA,  downstream forward: _UP4_TAATCATTTCTTGTACAAAA
BKK00370 (Δ[gene|E5110D9C36E8C55AFD1419987B14A53232165F20|abrB]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK00370 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTCTCCTCCCAAGAGATA,  downstream forward: _UP4_TAATCATTTCTTGTACAAAA
two-hybrid system
B. pertussis adenylate cyclase-based bacterial two hybrid system ([wiki|BACTH]), available in [wiki|Stülke] lab
labs
[wiki|Richard Losick], Harvard Univ., Cambridge, USA [http://www.mcb.harvard.edu/Losick/ homepage]
[wiki|Mark Strauch], Baltimore, USA [http://lifesciences.umaryland.edu/Pages/faculty_profile.aspx?ID=212 homepage]
References
Reviews
11964117,19995980,11931565,19202088,18326573,28886686
Original Publications
19581368,2437099,8878039,11377867,1850083,12586407,2554317,18430133,7768874,2507867,1766371,15687200,1908787,2106683,15687200,2504584,3145384,8821944,8576231,11101897,11395475,11583849,11751836,12123659,12076816,12591885,15610005,16223496,16159768,16702211,17660417,17720793,7592460,19465659,20509597,15101989,19202088,18326573,24534728,24731262,24832089,25002359,25308864,25381239,25790031,30356068,30808982,30980290,32949815,34565366,35392905,35608323,36372802
The [wiki|AbrB regulon]
20817675,18840696,23580539

E5110D9C36E8C55AFD1419987B14A53232165F20

Page visits: 15245

Time of last update: 2022-12-02 14:59:02

Author of last update: Jstuelk