SubtiWiki SubtiWiki
yqhB

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!

yqhB
168

similar to magnesium exporter, general stress protein, required for protection against oxidative stress

locus
BSU_24750
Molecular weight
49.79 kDa
pI
5.54
Protein length
Gene length
function
protection against stress conditions
product
unknown
essential
no
synonyms
yqhB

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1253

This gene is a member of the following regulons

Gene
Coordinates
2,561,585 → 2,562,913
The protein
Protein family
[wiki|UPF0053 family](according to UniProt)
[wiki|Domains]
[wiki|CNNM transmembrane domain] (aa 7-210) (according to UniProt)
[wiki|DUF21 domain] (14-210)
2 [wiki|CBS domain]s (aa 229-290, aa 295-355) (according to UniProt)
Structure
[PDB|4HG0] (CorC from E. coli, corresponds to the [wiki|CBS domain]s and the C-terminal transporter-associated domain)
Paralogous protein(s)
[protein|45F03AB13292BBF0554785C7C02FE29033EDD742|yrkA], [protein|A459410312A926365B45CEB4694DE399B38820A2|yugS], [protein|B2E9D026B668C8530C406353E3400059388566FB|yhdT], [protein|BE0777DE7C40825D4DB7252EA84AAB3892578529|mpfA]
[wiki|Localization]
cell membrane (according to UniProt)
Expression and Regulation
Operons
genes
[gene|E53B8D437B848B637AEC8C1BB9428EC8B6EB280E|yqhB]
description
[Pubmed|16267290]
regulation
induced by stress ([protein|search|SigB]) [Pubmed|15805528]
regulatory mechanism
[protein|D267AF38B0CF107042326E9B8F3DD3C9C85840E4|lexA]: repression, [Pubmed|16267290], in [regulon|protein:D267AF38B0CF107042326E9B8F3DD3C9C85840E4|lexA regulon]
sigma factors
[protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB]: sigma factor, [Pubmed|15805528], in [regulon|protein:580011DE5DC40EC9E7E0512791D328FAA010DCB8|sigB regulon]
Open in new tab

[gene|E53B8D437B848B637AEC8C1BB9428EC8B6EB280E|yqhB]

2022-01-27 01:11:36

ghost

3

aa802dcb866e1b8bfe88add8a5dd09009d796528

D4EB08D8CC6DF167D7839EFE03FE502094F3FEAA

Biological materials
Mutant
MGNA-C474 (yqhB::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2472 NBRP B. subtilis, Japan]
BKE24750 (Δ[gene|E53B8D437B848B637AEC8C1BB9428EC8B6EB280E|yqhB]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE24750 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGCACCTCCCTTTTCCGA,  downstream forward: _UP4_TAGCCCGTGAAAGGCTGTTC
BKK24750 (Δ[gene|E53B8D437B848B637AEC8C1BB9428EC8B6EB280E|yqhB]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK24750 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGCACCTCCCTTTTCCGA,  downstream forward: _UP4_TAGCCCGTGAAAGGCTGTTC
Expression vectors
pGP2935 (N-terminal His-tag, purification from ''E. coli'', in [wiki|pWH844]), available in [wiki|Jörg Stülke]'s lab
pGP3467 (223-359aa) (N-terminal 6xHis-tag, purification from E. coli, in [wiki|pWH844]), available in [wiki|Jörg Stülke]'s lab
pGP3472 (223-359aa) (N-terminal 6xHis-SUMO-tag, purification from E. coli, in pET-SUMO), available in [wiki|Jörg Stülke]'s lab
References
16267290,15805528,22582280,27933050,31415562

E53B8D437B848B637AEC8C1BB9428EC8B6EB280E

Page visits: 1715

Time of last update: 2022-01-27 08:39:00

Author of last update: LKrueger