yezF

yezF
168

unknown

locus
BSU_06559
Molecular weight
8.40 kDa
pI
9.733
Protein length
Gene length
function
unknown
product
unknown
essential
-
ec
null
synonyms
yezF

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms

This gene is a member of the following regulons

Gene
Coordinates
713,308 → 713,535
The protein
Structure
[AF|C0H3X3]
Biological materials
Mutant
BKE06559 (Δ[gene|E562F0C7A5CB9B9AEA3EFDF15138EC7D3497B89A|yezF]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE06559 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAAGGAAATCCGCTCCTTTT,  downstream forward: _UP4_AACGGATAAATGGAAAAGCT
BKK06559 (Δ[gene|E562F0C7A5CB9B9AEA3EFDF15138EC7D3497B89A|yezF]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK06559 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAAGGAAATCCGCTCCTTTT,  downstream forward: _UP4_AACGGATAAATGGAAAAGCT

E562F0C7A5CB9B9AEA3EFDF15138EC7D3497B89A

Page visits: 879

Time of last update: 2022-06-26 21:02:38

Author of last update: Bzhu