yjbL

yjbL
168

unknown

locus
BSU_11590
Molecular weight
13.92 kDa
pI
4.32
Protein length
Gene length
function
unknown
product
unknown
essential
no
synonyms
yjbL

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms

This gene is a member of the following regulons

Gene
Coordinates
1,236,609 → 1,236,977
The protein
Protein family
UPF0738 family (single member, according to UniProt)
Structure
[AF|O31610]
Expression and Regulation
Operons
genes
[gene|E5A57660B69F9E9BC52FD9C8A5E3C8786CE96728|yjbL]-[gene|81BCF5C08EC1A580F5E05884BA830130FC7E46E9|sasB]-[gene|2A2640A0501ECEA44A3C0C4842FAC053FB422A1F|nadF]-[gene|2AECDA9C4D0E704976B9E2168722EC80FE7A256D|yjbO]
description
[Pubmed|18067544]
regulation
expressed during exponential growth
Open in new tab

[gene|E5A57660B69F9E9BC52FD9C8A5E3C8786CE96728|yjbL]→[gene|2AECDA9C4D0E704976B9E2168722EC80FE7A256D|yjbO]

2022-11-30 18:37:17

Jstuelk

32

c5edd61e714281007d4d9ec99a1efa0cfef63f09

83E46551CBC32AB07130281546FE3D422612C2C3

additional information
the mRNA is cleaved by [protein|BAB297D18F94FFA67B8D12A684AB4D1BCDFB4981|RNase III] [PubMed|26883633]
Biological materials
Mutant
MGNA-B158 (yjbL::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1157 NBRP B. subtilis, Japan]
BKE11590 (Δ[gene|E5A57660B69F9E9BC52FD9C8A5E3C8786CE96728|yjbL]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE11590 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATAATGCTCTCCTTTTTTA,  downstream forward: _UP4_TAGAAACTGGTTCGGAATTG
BKK11590 (Δ[gene|E5A57660B69F9E9BC52FD9C8A5E3C8786CE96728|yjbL]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK11590 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATAATGCTCTCCTTTTTTA,  downstream forward: _UP4_TAGAAACTGGTTCGGAATTG
References
18067544,26883633

E5A57660B69F9E9BC52FD9C8A5E3C8786CE96728

Page visits: 1147

Time of last update: 2022-12-04 16:18:59

Author of last update: Melvin.boenninger