SubtiWiki SubtiWiki
sivA

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!

sivA
168

inhibitor of [protein|B29CAD04FB89ACC482EFCD29D50EDDA19145CAA2|kinA] autophosphorylation, and subsequently of entry into [wiki|sporulation]

locus
BSU_37800
Molecular weight
16.55 kDa
pI
7.18
Protein length
Gene length
function
control of entry into [wiki|sporulation] via the [wiki|phosphorelay]
product
inhibitor of [protein|B29CAD04FB89ACC482EFCD29D50EDDA19145CAA2|kinA] autophosphorylation
essential
no
synonyms
sivA, yweA, ipa-74d

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms

This gene is a member of the following regulons

Gene
Coordinates
3,882,191 → 3,882,655
Phenotypes of a mutant
the'' [gene|E5E2994D96FCECEE75E15136A08308C7B6C1C183|sivA] [gene|E06A3392E644FEDC6F46ED41BBE89168F59B76B3|bslA]'' double mutant exhibits a more severe loss of repellency of the biofilm surface as compared to the ''[gene|E06A3392E644FEDC6F46ED41BBE89168F59B76B3|bslA]'' mutant [Pubmed|22571672]
The protein
Catalyzed reaction/ biological activity
inhibits [protein|B29CAD04FB89ACC482EFCD29D50EDDA19145CAA2|kinA] autophophorylation [Pubmed|23335417]
Protein family
BslA/BslB family (with [protein|E06A3392E644FEDC6F46ED41BBE89168F59B76B3|bslA], according to UniProt)
Structure
[PDB|5MKD]
Paralogous protein(s)
[protein|E06A3392E644FEDC6F46ED41BBE89168F59B76B3|bslA]
[wiki|Localization]
membrane (according to Swiss-Prot)
extracellular (signal peptide) [Pubmed|18957862]
Expression and Regulation
Operons
genes
[gene|E5E2994D96FCECEE75E15136A08308C7B6C1C183|sivA]
description
[Pubmed|12823818]
regulatory mechanism
[protein|E5110D9C36E8C55AFD1419987B14A53232165F20|abrB]: repression, [Pubmed|20817675], in [regulon|protein:E5110D9C36E8C55AFD1419987B14A53232165F20|abrB regulon]
Open in new tab

[gene|E5E2994D96FCECEE75E15136A08308C7B6C1C183|sivA]

2021-12-25 21:02:08

ghost

1

9e16e1df2569910a01de4de968987dc38f86269e

E174DF46E7B44987A595F4854342C0701B526E5D

Biological materials
Mutant
MGNA-B238 (yweA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1237 NBRP B. subtilis, Japan]
BKE37800 (Δ[gene|E5E2994D96FCECEE75E15136A08308C7B6C1C183|sivA]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE37800 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGACATTTCCCCCTAATT,  downstream forward: _UP4_TAATCGATAGATTTGTAGTC
BKK37800 (Δ[gene|E5E2994D96FCECEE75E15136A08308C7B6C1C183|sivA]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK37800 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGACATTTCCCCCTAATT,  downstream forward: _UP4_TAATCGATAGATTTGTAGTC
References
18957862,12823818,22571672,23335417,20817675,28698374,28751732

E5E2994D96FCECEE75E15136A08308C7B6C1C183

Page visits: 1173

Time of last update: 2022-01-17 21:40:14

Author of last update: Melvin.boenninger