SubtiWiki SubtiWiki

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!


lactate permease

Molecular weight
59.59 kDa
Protein length
Gene length
lactate uptake
lactate permease
lutP, yvfH

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1620

This gene is a member of the following regulons

3,510,780 → 3,512,471
Phenotypes of a mutant
poor growth with lactate as single carbon source [Pubmed|19201793]
The protein
Catalyzed reaction/ biological activity
lactate uptake [Pubmed|19201793]
Protein family
lactate permease family (with [protein|84D391ED4E81BC17FC2A115985962445D7996DFA|lctP], according to UniProt)
Paralogous protein(s)
membrane [Pubmed|18763711]
Expression and Regulation
expressed at high cell density ([protein|search|ComA]) [Pubmed|16091051]
regulatory mechanism
[protein|7832489F11F606BCF637EC23BAAB41AD10237EBB|comA]: activation, ([protein|7832489F11F606BCF637EC23BAAB41AD10237EBB|comA]) [Pubmed|16091051], in [regulon|protein:7832489F11F606BCF637EC23BAAB41AD10237EBB|comA regulon]
[protein|E6F3BAC5875A16D8D75B2AD21447C14DD17B3DA6|lutR]: repression, in [regulon|protein:E6F3BAC5875A16D8D75B2AD21447C14DD17B3DA6|lutR regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|25031425], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab


2021-10-15 16:41:01





Biological materials
MGNA-A489 (yvfH::erm), available at the [ NBRP B. subtilis, Japan]
BKE34190 (Δ[gene|E607B0D57398BCCF64CF3CE2110E632B0C3A109E|lutP]::erm  trpC2) available at [ BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCCCAAACCCCTCCTTGA,  downstream forward: _UP4_TAAAAAAATCCTCCCGTCTA
BKK34190 (Δ[gene|E607B0D57398BCCF64CF3CE2110E632B0C3A109E|lutP]::kan  trpC2) available at [ BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCCCAAACCCCTCCTTGA,  downstream forward: _UP4_TAAAAAAATCCTCCCGTCTA
[wiki|Richard Losick], Harvard Univ., Cambridge, USA [ homepage]


Page visits: 2132

Time of last update: 2022-01-18 09:02:45

Author of last update: Melvin.boenninger