lutP

lutP
168

lactate permease

locus
BSU_34190
Molecular weight
59.59 kDa
pI
9.48
Protein length
Gene length
function
lactate uptake
product
lactate permease
essential
no
synonyms
lutP, yvfH

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1620

This gene is a member of the following regulons

Gene
Coordinates
3,510,780 → 3,512,471
Phenotypes of a mutant
poor growth with lactate as single carbon source [Pubmed|19201793]
The protein
Catalyzed reaction/ biological activity
lactate uptake [Pubmed|19201793]
Protein family
lactate permease family (with [protein|84D391ED4E81BC17FC2A115985962445D7996DFA|lctP], according to UniProt)
Structure
[AF|P71067]
Paralogous protein(s)
[protein|84D391ED4E81BC17FC2A115985962445D7996DFA|lctP]
[wiki|Localization]
membrane [Pubmed|18763711]
Expression and Regulation
Operons
genes
[gene|E607B0D57398BCCF64CF3CE2110E632B0C3A109E|lutP]
description
[Pubmed|22383849]
regulation
expressed at high cell density ([protein|search|ComA]) [Pubmed|16091051]
regulatory mechanism
[protein|7832489F11F606BCF637EC23BAAB41AD10237EBB|comA]: activation, ([protein|7832489F11F606BCF637EC23BAAB41AD10237EBB|comA]) [Pubmed|16091051], in [regulon|protein:7832489F11F606BCF637EC23BAAB41AD10237EBB|comA regulon]
[protein|E6F3BAC5875A16D8D75B2AD21447C14DD17B3DA6|lutR]: repression, in [regulon|protein:E6F3BAC5875A16D8D75B2AD21447C14DD17B3DA6|lutR regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|25031425], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|E607B0D57398BCCF64CF3CE2110E632B0C3A109E|lutP]

2022-06-22 01:40:15

ghost

8

4d0a139f9c188bf8fb1d1ab5397a4e19d54a602b

A3F48CABDA805CB9E58EED1FC0BD3CFC9B204033

Biological materials
Mutant
MGNA-A489 (yvfH::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/489 NBRP B. subtilis, Japan]
BKE34190 (Δ[gene|E607B0D57398BCCF64CF3CE2110E632B0C3A109E|lutP]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE34190 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCCCAAACCCCTCCTTGA,  downstream forward: _UP4_TAAAAAAATCCTCCCGTCTA
BKK34190 (Δ[gene|E607B0D57398BCCF64CF3CE2110E632B0C3A109E|lutP]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK34190 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCCCAAACCCCTCCTTGA,  downstream forward: _UP4_TAAAAAAATCCTCCCGTCTA
labs
[wiki|Richard Losick], Harvard Univ., Cambridge, USA [http://www.mcb.harvard.edu/Losick/ homepage]
References
19201793,18763711,16091051,25031425,26582911

E607B0D57398BCCF64CF3CE2110E632B0C3A109E

Page visits: 2434

Time of last update: 2022-06-25 20:27:58

Author of last update: Melvin.boenninger