ywhH

ywhH
168

unknown

locus
BSU_37480
Molecular weight
17.33 kDa
pI
5.28
Protein length
Gene length
function
unknown
product
unknown
essential
no
synonyms
ywhH

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG2606

This gene is a member of the following regulons

Gene
Coordinates
3,847,348 → 3,847,821
The protein
Structure
[PDB|2CX5] (from Thermus thermophilus, 35% identity)
[AF|P71000]
Expression and Regulation
Operons
genes
[gene|E6A3987180F234472110FDA29B7545307F897FD0|ywhH]
description
[Pubmed|9353933]
regulation
induced at high cell density ([protein|search|ComA]) [Pubmed|16091051]
regulatory mechanism
[protein|7832489F11F606BCF637EC23BAAB41AD10237EBB|comA]: activation, [Pubmed|16091051], in [regulon|protein:7832489F11F606BCF637EC23BAAB41AD10237EBB|comA regulon]
Open in new tab

[gene|E6A3987180F234472110FDA29B7545307F897FD0|ywhH]

2022-11-30 12:43:11

ghost

12

b199f70d31d4d3051c0b0d062fdab170baf6e171

8A1DA34FB56388106A410ED88A38EFD19C23A5E6

Biological materials
Mutant
MGNA-B666 (ywhH::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1665 NBRP B. subtilis, Japan]
BKE37480 (Δ[gene|E6A3987180F234472110FDA29B7545307F897FD0|ywhH]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE37480 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGCTGCATTTCCACTCTC,  downstream forward: _UP4_TAAAAAAACATCCAGACATC
BKK37480 (Δ[gene|E6A3987180F234472110FDA29B7545307F897FD0|ywhH]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK37480 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGCTGCATTTCCACTCTC,  downstream forward: _UP4_TAAAAAAACATCCAGACATC
References
9353933,16091051

E6A3987180F234472110FDA29B7545307F897FD0

Page visits: 1234

Time of last update: 2022-12-09 09:37:09

Author of last update: Jstuelk