SubtiWiki SubtiWiki
ydzN

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!

ydzN
168

unknown

locus
BSU_05109
Molecular weight
7.00 kDa
pI
9.745
Protein length
Gene length
function
unknown
product
unknown
essential
-
ec
null
synonyms
ydzN

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms

This gene is a member of the following regulons

Gene
Coordinates
557,873 → 558,058
Expression and Regulation
Operons
genes
[gene|E6BD1DCC68E08DC8D6E684576A6638872A9FE432|ydzN]
description
[pubmed|22383849]
Open in new tab

[gene|E6BD1DCC68E08DC8D6E684576A6638872A9FE432|ydzN]

2021-04-14 19:58:14

Jstuelk

1

091d3d715a88fbe0d6ecbe318f4063a3ea29974d

502E55359810B5ADC1FB01551AD05A262756CF20

Biological materials
Mutant
BKE05109 (Δ[gene|E6BD1DCC68E08DC8D6E684576A6638872A9FE432|ydzN]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE05109 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAATTAAAAACTCCTTTTTA,  downstream forward: _UP4_TAAAAGTCATAAAGTTGGGA
BKK05109 (Δ[gene|E6BD1DCC68E08DC8D6E684576A6638872A9FE432|ydzN]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK05109 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAATTAAAAACTCCTTTTTA,  downstream forward: _UP4_TAAAAGTCATAAAGTTGGGA

E6BD1DCC68E08DC8D6E684576A6638872A9FE432

Page visits: 734

Time of last update: 2022-01-18 17:00:32

Author of last update: Bzhu