yfkL

yfkL
168

similar to multidrug resistance protein

locus
BSU_07860
Molecular weight
42.01 kDa
pI
9.67
Protein length
Gene length
function
unknown
product
unknown
essential
no
synonyms
yfkL

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG2814

This gene is a member of the following regulons

Gene
Coordinates
860,303 → 861,493
The protein
Protein family
[wiki|major facilitator superfamily] (according to UniProt)
Structure
[AF|O34597]
[wiki|Localization]
membrane (according to UniProt)
Expression and Regulation
Operons
genes
[gene|E8B1846CEF630C3CD89B3A92E9D8BE9DBC84FD68|yfkK]-[gene|E6C213ABCE165A54897A7DB5EE24481B94A4CDD0|yfkL]
description
[Pubmed|22383849]
Open in new tab

[gene|E8B1846CEF630C3CD89B3A92E9D8BE9DBC84FD68|yfkK]→[gene|E6C213ABCE165A54897A7DB5EE24481B94A4CDD0|yfkL]

2022-11-28 11:52:29

Jstuelk

17

7245981f01c20c30c993e1245e4017d9736ccb3b

4977027B0F46EF767C6FE5774A4D3D5736E78670

Biological materials
Mutant
MGNA-C265 (yfkL::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2263 NBRP B. subtilis, Japan]
BKE07860 (Δ[gene|E6C213ABCE165A54897A7DB5EE24481B94A4CDD0|yfkL]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE07860 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGCTTGTACTCCTTCAAA,  downstream forward: _UP4_TAAGCAACAAAAAAACGGAC
BKK07860 (Δ[gene|E6C213ABCE165A54897A7DB5EE24481B94A4CDD0|yfkL]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK07860 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGCTTGTACTCCTTCAAA,  downstream forward: _UP4_TAAGCAACAAAAAAACGGAC

E6C213ABCE165A54897A7DB5EE24481B94A4CDD0

Page visits: 1231

Time of last update: 2022-12-04 13:23:50

Author of last update: Jstuelk