lutR
Register now for Subtillery 2022, the International Online Meeting on Bacillus subtilis! It will be held from the 19th-22th of September.

lutR
168

transcriptional repressor ([wiki|GntR family]) of the [gene|FEC83B66CEA311EA1650D61A215F82E9DF4E9F03|lutA]-[gene|57B9E37F6232189CD47C1B41FDCF43FCB8016AEB|lutB]-[gene|search|lutC ]operon and of [gene|E607B0D57398BCCF64CF3CE2110E632B0C3A109E|lutP]

locus
BSU_34180
Molecular weight
19.50 kDa
pI
4.84
Protein length
Gene length
function
control of lactate utilization
product
transcriptional repressor, ([wiki|GntR family])
essential
no
synonyms
lutR, yvfI

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG2186

This gene is a member of the following regulons

Gene
Coordinates
3,509,831 → 3,510,490
The protein
Catalyzed reaction/ biological activity
transcriptional repressor of the [gene|FEC83B66CEA311EA1650D61A215F82E9DF4E9F03|lutA]-[gene|57B9E37F6232189CD47C1B41FDCF43FCB8016AEB|lutB]-[gene|5EE69198882DF4E9AB8D9D7267F071EF88C2F16D|lutC] operon [Pubmed|19201793]
Protein family
[wiki|GntR family] of transcription factors
[wiki|Domains]
[wiki|HTH gntR-type domain] (aa 1-56) (according to UniProt)
Structure
[PDB|6AZ6] ([protein|1C566E54F8EF1A17A365FC49DFDA452AC5D0CA64|gntR] from Streptococcus agalactiae, 30% identity) [pubmed|29269393]
[AF|O07007]
Effectors of protein activity
lactate acts as molecular inducer [Pubmed|19201793]
Expression and Regulation
Operons
genes
[gene|E6F3BAC5875A16D8D75B2AD21447C14DD17B3DA6|lutR]
description
[pubmed|22383849]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|25031425], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|E6F3BAC5875A16D8D75B2AD21447C14DD17B3DA6|lutR]

2022-08-16 06:41:41

Bzhu

12

f1dc528fccd88d8360faa91099cb54f85aca4bc6

E77BC538D111921704345E18D5A6303A429BB66F

Biological materials
Mutant
MGNA-B607 (yvfI::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1606 NBRP B. subtilis, Japan]
TEK1 lutR::Tn10::spc [Pubmed|24196425]
BKE34180 (Δ[gene|E6F3BAC5875A16D8D75B2AD21447C14DD17B3DA6|lutR]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE34180 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATATCTAATAGGGCATCCG,  downstream forward: _UP4_TAACCAACTCATTTCCCGGG
BKK34180 (Δ[gene|E6F3BAC5875A16D8D75B2AD21447C14DD17B3DA6|lutR]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK34180 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATATCTAATAGGGCATCCG,  downstream forward: _UP4_TAACCAACTCATTTCCCGGG
Expression vectors
pQE60-lutR (His-tag) [Pubmed|24196425]
lacZ fusion
TEK7 lutR::lacZ::erm [Pubmed|24196425]
labs
[wiki|Richard Losick], Harvard Univ., Cambridge, USA [http://www.mcb.harvard.edu/Losick/ homepage]
[wiki|Ayten Katatas], Istanbul Technical University, Istanbul, Turkey [http://www.bio.itu.edu.tr/personel_data/personel_ayten_yazgan_karatas.htm x]
References
24196425,19201793,25031425,18604637,29269393

E6F3BAC5875A16D8D75B2AD21447C14DD17B3DA6

Page visits: 4094

Time of last update: 2022-08-16 20:16:50

Author of last update: Melvin.boenninger