fecF

fecF
168

iron/citrate ABC transporter (ATP-binding protein)

locus
BSU_07490
Molecular weight
29.31 kDa
pI
6.07
Protein length
Gene length
function
iron uptake
product
iron/citrate ABC transporter (ATP-binding protein)
essential
no
ec
3.6.3.-
synonyms
fecF, yfmF

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1120

This gene is a member of the following regulons

Gene
Coordinates
822,903 → 823,703
The protein
Protein family
[wiki|ABC transporter superfamily] (according to UniProt)
[wiki|Domains]
[wiki|ABC transporter domain] (aa 4-240) (according to UniProt)
Structure
[PDB|4G1U] (from ''Yersinia pestis'', the [protein|BDAA56484E05DA3C1CB0CA09873A365657999679|fecD]-[protein|800EAB1D8617589CCAC68FB874EFCDE4C77962E1|fecE]-[protein|E76640F895261DA34AD2342B54B43D11857AEA9A|fecF] complex, 32% identity) [Pubmed|23142986]
[AF|O34510]
Paralogous protein(s)
[protein|E70BE74D5AB4B06CDFF902E58A0B9EBF477E21EC|fhuC], [protein|473628F86C18FE9957841F3C8B45242C90CB341D|fpbP], [protein|5C52DB31F378E49AABE5D937DD901A68F3810477|yusV]
[wiki|Localization]
associated to the membrane (via [protein|BDAA56484E05DA3C1CB0CA09873A365657999679|fecD]-[protein|800EAB1D8617589CCAC68FB874EFCDE4C77962E1|fecE]) [Pubmed|10092453]
Expression and Regulation
Operons
genes
[gene|569510093E5B69A0368205920A21A81CADF030E9|fecC]-[gene|BDAA56484E05DA3C1CB0CA09873A365657999679|fecD]-[gene|800EAB1D8617589CCAC68FB874EFCDE4C77962E1|fecE]-[gene|E76640F895261DA34AD2342B54B43D11857AEA9A|fecF]
description
[Pubmed|16672620]
regulation
immediately induced upon iron starvation (first wave to allow iron uptake) ([protein|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|fur]) [Pubmed|29133393,16672620,12354229]
regulatory mechanism
[protein|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|fur]: repression, [Pubmed|16672620,12354229], in [regulon|protein:F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|fur regulon]
Open in new tab

[gene|569510093E5B69A0368205920A21A81CADF030E9|fecC]→[gene|E76640F895261DA34AD2342B54B43D11857AEA9A|fecF]

2022-11-28 13:17:22

Jstuelk

20

08d0c1575e8a6211c799093cfc6ee3a9c3135a88

49520E691347BD8533B6CD8A50C6130F3DA7A9DB

Biological materials
Mutant
MGNA-C244 (yfmF::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2242 NBRP B. subtilis, Japan]
BKE07490 (Δ[gene|E76640F895261DA34AD2342B54B43D11857AEA9A|fecF]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE07490 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAGTTTTCCCATGGTATCCT,  downstream forward: _UP4_TGAAAAGGAGAGGAATTCCC
BKK07490 (Δ[gene|E76640F895261DA34AD2342B54B43D11857AEA9A|fecF]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK07490 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAGTTTTCCCATGGTATCCT,  downstream forward: _UP4_TGAAAAGGAGAGGAATTCCC
References
10092453,16672620,23142986,29133393

E76640F895261DA34AD2342B54B43D11857AEA9A

Page visits: 2146

Time of last update: 2022-11-28 22:28:24

Author of last update: Melvin.boenninger