sigX

sigX
168

[wiki|RNA polymerase] ECF-type [wiki|sigma factor] SigX, required for resistance against cationic antimicrobial peptides, required for temporary phage resistance

locus
BSU_23100
Molecular weight
23.03 kDa
pI
6.09
Protein length
Gene length
function
resistance to cationic antimcrobial peptides
product
[wiki|RNA polymerase] ECF-type [wiki|sigma factor] SigX
essential
no
synonyms
sigX, ypuM

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1595

This gene is a member of the following regulons

Gene
Coordinates
2,414,627 → 2,415,211
The protein
Protein family
[wiki|Sigma-70 factor family] (according to UniProt)
[wiki|ECF subfamily] (according to UniProt)
Structure
[PDB|6DXO] (from Streptomyces venezuelae, 28% identity) [pubmed|29905823]
[AF|P35165]
[wiki|Localization]
cell membrane (according to UniProt)
Additional information
[protein|E77364F274A520FCCA9F5C9504E317B047BA29E6|sigX] is activated in non-infected cell following phage infection of neighbor cells [pubmed|34878184]
Expression of the [wiki|SigX regulon] in increased in ''[gene|7A606B8E952AE8CA4F9A62008BA4B156725BB5B5|ugtP]'' mutants [Pubmed|22362028]
Expression and Regulation
Operons
genes
[gene|E77364F274A520FCCA9F5C9504E317B047BA29E6|sigX]-[gene|21D260E900776EAAF4B6000A3365DCA9241EACA6|rsiX]
description
[Pubmed|7934830]
regulation
induced by glucose [Pubmed|27965645], this depends on [protein|F4097349A563503468A2A14F062AEAC532C7917A|ylxR] [pubmed|30355672]
regulatory mechanism
[protein|7098319D8E88FDC2A629A3F4A21507FD7A649385|yvrHb]: activation, [Pubmed|16306698], in [regulon|protein:7098319D8E88FDC2A629A3F4A21507FD7A649385|yvrHb regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|9636707], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
[protein|E77364F274A520FCCA9F5C9504E317B047BA29E6|sigX]: sigma factor, [Pubmed|9636707], in [regulon|protein:E77364F274A520FCCA9F5C9504E317B047BA29E6|sigX regulon]
Open in new tab

[gene|E77364F274A520FCCA9F5C9504E317B047BA29E6|sigX]→[gene|21D260E900776EAAF4B6000A3365DCA9241EACA6|rsiX]

2022-06-15 17:10:05

Jstuelk

18

dfd4194b5990a1043dfc2b94c54efc3adc6fd3a9

F164A2C76E6C51307B22A33B48976CF41577CBAC

Biological materials
Mutant
MGNA-A179 (sigX::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/179 NBRP B. subtilis, Japan]
1A901 ( ''sigX''::''spec''), [Pubmed| ], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A901&Search=1A901 BGSC]
BKE23100 (Δ[gene|E77364F274A520FCCA9F5C9504E317B047BA29E6|sigX]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE23100 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTTGAAACCCCTCCGTTC,  downstream forward: _UP4_GAGCTTTTGAGGGAGGAGCT
BKK23100 (Δ[gene|E77364F274A520FCCA9F5C9504E317B047BA29E6|sigX]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK23100 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATTTGAAACCCCTCCGTTC,  downstream forward: _UP4_GAGCTTTTGAGGGAGGAGCT
References
Reviews
24921931,26901131
Other original publications
11222589,9139908,14993308,12399481,14762009,19047346,14651641,19465659,9636707,16306698,7934830,19767430,9393439,22362028,23103977,20817771,26364265,27137497,27965645,30355672,29905823,31118925,34864869,34878184
The [wiki|SigX regulon]
9683469,17675383,10960106

E77364F274A520FCCA9F5C9504E317B047BA29E6

Page visits: 3858

Time of last update: 2022-06-23 03:41:55

Author of last update: Jstuelk