yfiC

yfiC
168

similar to [wiki|ABC transporter] (ATP-binding protein)

locus
BSU_08220
Molecular weight
67.22 kDa
pI
9.62
Protein length
Gene length
function
unknown
product
[wiki|ABC transporter] (ATP-binding protein)
essential
no
synonyms
yfiC

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1132

This gene is a member of the following regulons

Gene
Coordinates
895,619 → 897,433
The protein
Protein family
[wiki|ABC transporter superfamily] (according to UniProt)
[wiki|Domains]
has both a membrane-spanning and an ATP-binding domain [Pubmed|10092453]
[wiki|ABC transmembrane type-1 domain] (aa 49-332) (according to UniProt)
[wiki|ABC transporter domain] (aa 366-600) (according to UniProt)
Structure
[PDB|3QF4] ([protein|288CA73D93B1E5106E1C6CE5E7E2E8BE2A6BD3F3|yfiB]-[protein|E85814EDF232D21A42380D559EAD2CDFB41F19DB|yfiC] complex from Thermotoga maritima, 48% identity) [pubmed|22447242]
[AF|P54719]
Paralogous protein(s)
[protein|ED1F82463BAA28B67184BFAB5CB23CF26A62999D|bmrA], [protein|70D7098BEBD5E53B4B9B8C3394FAAF972C65EE22|yknU], [protein|C6B0ACB9D9703DD8141FD7D9D62DB22FB48F458B|yknV], [protein|0EB4D3E1B9AF39ECCBD79EB559FAE5BB0EE4C156|ygaD], [protein|D5A3C316BD4567A0155F70330E32ACDE18F063FE|ywjA], [protein|67C0C9EA17EF953554D3D57CD0D285246F50C1AD|bmrC], [protein|288CA73D93B1E5106E1C6CE5E7E2E8BE2A6BD3F3|yfiB]
[wiki|Localization]
cell membrane [Pubmed|10092453]
Expression and Regulation
Operons
genes
[gene|288CA73D93B1E5106E1C6CE5E7E2E8BE2A6BD3F3|yfiB]-[gene|E85814EDF232D21A42380D559EAD2CDFB41F19DB|yfiC]
description
[pubmed|22383849]
Open in new tab

[gene|288CA73D93B1E5106E1C6CE5E7E2E8BE2A6BD3F3|yfiB]→[gene|E85814EDF232D21A42380D559EAD2CDFB41F19DB|yfiC]

2022-11-27 13:20:54

Jstuelk

18

4c57fdf34e3ec7eb7b03ff0d8072df76ee03fc27

8BC3C441B6D7A4146D2BF5E5541BE11627299F1B

Biological materials
Mutant
MGNA-C293 (yfiC::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2291 NBRP B. subtilis, Japan]
BKE08220 (Δ[gene|E85814EDF232D21A42380D559EAD2CDFB41F19DB|yfiC]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE08220 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_TTGGAAAGGCTTGCGGATGT,  downstream forward: _UP4_TAGACCTTTGTCCTGCACAG
BKK08220 (Δ[gene|E85814EDF232D21A42380D559EAD2CDFB41F19DB|yfiC]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK08220 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_TTGGAAAGGCTTGCGGATGT,  downstream forward: _UP4_TAGACCTTTGTCCTGCACAG
References
10092453,22447242

E85814EDF232D21A42380D559EAD2CDFB41F19DB

Page visits: 1038

Time of last update: 2022-11-28 21:17:52

Author of last update: Melvin.boenninger