

Ser/Thr kinase, controls [category|SW.3.3.1|Translation] and DNA integrity during spore development

Molecular weight
37.51 kDa
Protein length
Gene length
control of DNA integrity during spore development
Ser/Thr kinase

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0515

This gene is a member of the following regulons

73,809 → 74,825
Phenotypes of a mutant
increased sensitivity to DNA damage during spore development [Pubmed|23634894]
The protein
Catalyzed reaction/ biological activity
phosphorylation of [protein|A44D4677FB70BE8F554BF1001A500F817C7DA95F|recA] on Ser-2 [Pubmed|23634894]
phosphorylation of [gene|E771685D6D41D48E0C0AF77F15B4F380820FCDC2|EF-Tu] on Thr-63 during [wiki|sporulation] [Pubmed|26056311]
phosphorylation of [protein|A039228A3805F4E7C5C2AE31C7DB0808562E88E3|yabA] on Thr-71 [pubmed|29619013]
ATP + L-seryl-[protein] --> ADP + H+ + O-phospho-L-seryl-[protein] (according to UniProt)
ATP + L-threonyl-[protein] --> ADP + H+ + O-phospho-L-threonyl-[protein] (according to UniProt)
Protein family
[wiki|protein kinase superfamily] (according to UniProt)
[wiki|Ser/Thr protein kinase family] (according to UniProt)
[wiki|Protein kinase domain] (aa 28-286) (according to UniProt)
[PDB|6G4J] [pubmed|30671027]
Effectors of protein activity
autophosphorylation is stimulated by non-specific binding to DNA [Pubmed|23634894]
colocalizes strongly with the septal membrane separating the mother cells from the forespore [Pubmed|23634894]
Expression and Regulation
expressed early during sporulation in the forespore ([protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|sigF]) [Pubmed|16497325]
sigma factors
[protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|sigF]: sigma factor, [Pubmed|16497325], in [regulon|protein:CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|sigF regulon]
Open in new tab


2022-11-25 17:00:23





Biological materials
MGNA-B921 (yabT::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1920 NBRP B. subtilis, Japan]
GP577 (erm), available in [wiki|Jörg Stülke]'s lab
BKE00660 (Δ[gene|E86A96B832351FF513DD9853EAD8998CC44C9951|yabT]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE00660 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_TTTGATTGTCGTACCCGGCT,  downstream forward: _UP4_TGAATGGTGCAAACTGCAGA
BKK00660 (Δ[gene|E86A96B832351FF513DD9853EAD8998CC44C9951|yabT]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK00660 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_TTTGATTGTCGTACCCGGCT,  downstream forward: _UP4_TGAATGGTGCAAACTGCAGA
Expression vectors
purification from ''B. subtilis'' with N-terminal Strep-tag, for [wiki|SPINE], in [wiki|pGP380]: pGP391, available in [wiki|Jörg Stülke]'s lab
purification from ''E. coli'' with N-terminal Strep-tag, in [wiki|pGP172]: pGP823, available in [wiki|Jörg Stülke]'s lab, [pubmed|20389117]
purification from ''E. coli'' with N-terminal His-tag, in [wiki|pWH844]: pGP1408, available in [wiki|Jörg Stülke]'s lab
lacZ fusion
translational lacZ fusion (in [wiki|pAC7]): pGP831, available in [wiki|Jörg Stülke]'s lab
Original Publications


Page visits: 2701

Time of last update: 2022-11-26 09:45:53

Author of last update: Melvin.boenninger