licA

licA
168

lichenan-specific permease of the [wiki|phosphotransferase systems|phosphotransferase system], EIIA of the [category|SW.1.2.2|PTS]

locus
BSU_38570
Molecular weight
12.04 kDa
pI
4.64
Protein length
Gene length
function
lichenan uptake and phosphorylation
product
lichenan-specific [category|SW.1.2.2|PTS], EIIA component
essential
no
synonyms
licA, celC

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1447

This gene is a member of the following regulons

Gene
Coordinates
3,959,841 → 3,960,173
The protein
Protein family
[category|SW.1.2.2|PTS] permease, lactose family [Pubmed|10627040]
[wiki|Domains]
[wiki|PTS EIIA domain] type-3 (aa 3-101) (according to UniProt)
Structure
[PDB|3K1S] (IIA(Cel) from ''B. anthracis'', 42% identity)
[AF|P46319]
Paralogous protein(s)
[protein|44014896157718D3A6190DFDBD663C5CB9DA63FC|gmuA]
[wiki|Localization]
cytoplasm (according to Swiss-Prot)
Expression and Regulation
Operons
genes
[gene|65FC7F4ED92F747DB7BC5672DCA2D2320A471134|licB]-[gene|83A7C160B0301A2B51B65478D99ACB753D67AF74|licC]-[gene|E8B6C8E722BEE866878CDD816B7828C132F94FCD|licA]-[gene|84D8AA0AFBF46273F6B4198B49440D55470FEC0F|licH]
description
[Pubmed|8990303]
regulation
carbon catabolite repression ([protein|search|CcpA]) [Pubmed|8990303]
regulatory mechanism
[protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA]: repression, [Pubmed|8990303], in [regulon|protein:E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA regulon]
[protein|E087ABA705CE94E2CAD44A0F2FB265B0F7B04399|licR]: activation, [Pubmed|8990303], in [regulon|protein:E087ABA705CE94E2CAD44A0F2FB265B0F7B04399|licR regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|8990303], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|65FC7F4ED92F747DB7BC5672DCA2D2320A471134|licB]→[gene|84D8AA0AFBF46273F6B4198B49440D55470FEC0F|licH]

2022-11-25 12:14:04

ghost

26

71a5a6a29188848adbfdb06b462667b975c2c7f8

DF3BDC652C79EB094E8D2D2CE50175B714C16E84

Biological materials
Mutant
BKE38570 (Δ[gene|E8B6C8E722BEE866878CDD816B7828C132F94FCD|licA]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE38570 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_ATTCACGCGATTCACTTCCT,  downstream forward: _UP4_ACCGAGCAAAGGGGAGCAAG
BKK38570 (Δ[gene|E8B6C8E722BEE866878CDD816B7828C132F94FCD|licA]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK38570 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_ATTCACGCGATTCACTTCCT,  downstream forward: _UP4_ACCGAGCAAAGGGGAGCAAG
References
19087206,8990303,16872404,10438772,10627040,8990303,27766092

E8B6C8E722BEE866878CDD816B7828C132F94FCD

Page visits: 2415

Time of last update: 2022-11-30 16:03:21

Author of last update: Melvin.boenninger