SubtiWiki SubtiWiki
ydgJ

The 21st International Conference on Bacilli will take place in Prague on 14-17 June 2022!

ydgJ
168

similar to transcriptional regulator ([wiki|MarR family])

locus
BSU_05670
Molecular weight
18.66 kDa
pI
9.35
Protein length
Gene length
function
unknown
product
unknown
essential
no
synonyms
ydgJ

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1846

This gene is a member of the following regulons

Gene
Coordinates
612,836 → 613,330
The protein
Protein family
[wiki|MarR family]
[wiki|Domains]
[wiki|HTH marR-type domain] (aa 28-157) (according to UniProt)
Structure
[PDB|3BDD] (MarR from Streptococcus suis, corresponds to aa 27 ... 134, 37% identity)
Expression and Regulation
Operons
genes
[gene|E8D1416DB588A4D72E84341F5EAB845E77A84792|ydgJ]-[gene|8EE3F368AB1CD4BB14E42135D63D27138D3FED03|ydgI]
description
[Pubmed|22383849]
Open in new tab

[gene|E8D1416DB588A4D72E84341F5EAB845E77A84792|ydgJ]→[gene|8EE3F368AB1CD4BB14E42135D63D27138D3FED03|ydgI]

2022-01-21 08:09:26

Jstuelk

3

ec9aeeca5325de7fd1650ae94fc77d010889b9d5

945FDB772C0F2B2190B78E1D3B6E21D9079DE00C

Biological materials
Mutant
MGNA-C162 (ydgJ::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2160 NBRP B. subtilis, Japan]
BKE05670 (Δ[gene|E8D1416DB588A4D72E84341F5EAB845E77A84792|ydgJ]::erm  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE05670 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAATTAATATACAACGATTG,  downstream forward: _UP4_GAAGCTTAAGAGGAGTGTAT
BKK05670 (Δ[gene|E8D1416DB588A4D72E84341F5EAB845E77A84792|ydgJ]::kan  trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK05670 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAATTAATATACAACGATTG,  downstream forward: _UP4_GAAGCTTAAGAGGAGTGTAT

E8D1416DB588A4D72E84341F5EAB845E77A84792

Page visits: 1177

Time of last update: 2022-01-21 15:10:22

Author of last update: Jstuelk