yuiG

yuiG
168

putative S protein of a second biotin [wiki|ECF transporter]

locus
BSU_32030
Molecular weight
21.39 kDa
pI
10.63
Protein length
Gene length
function
unknown
product
putative S protein of an [wiki|ECF transporter]
essential
no
synonyms
yuiG

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1268 (Galperin et al., 2021)

This gene is a member of the following regulons

Gene
Coordinates
3,294,270 → 3,294,872
The protein
Protein family
bioY family (with [protein|22215066A7BEA4E53189DE6639C19D1AD86DA7F4|panU], according to UniProt)
Structure
[PDB|4DVE] (BioY from ''Lactococcus lactis'', 27% identity, 59% similarity) [Pubmed|22891302]
[AF|O32104]
[wiki|Localization]
membrane [Pubmed|18763711]
Expression and Regulation
Operons
genes
[gene|E98078C3CB9F19949009A8E50340E4C9E67663E6|yuiG]
description
[pubmed|22383849]
regulatory mechanism
[protein|F761DBCE3429C99159F8F7CD8596FD9CF2D0589D|birA]: repression, [Pubmed|11717296], in [regulon|protein:F761DBCE3429C99159F8F7CD8596FD9CF2D0589D|birA regulon]
Open in new tab

[gene|E98078C3CB9F19949009A8E50340E4C9E67663E6|yuiG]

2025-10-14 07:15:38

Bzhu

85

6c1fc93b8b9b4ebb3909094ceaaad16aaf0e6055

CFF015A0071E53672BBDD845D74313880537444B

Biological materials
Mutant
GP4748 (trpC2 Δ[gene|E98078C3CB9F19949009A8E50340E4C9E67663E6|yuiG]::neo), available in [wiki|Jörg Stülke]'s lab
MGNA-B567 (yuiG::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1566 NBRP B. subtilis, Japan]
BKE32030 (Δ[gene|E98078C3CB9F19949009A8E50340E4C9E67663E6|yuiG]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE32030 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCGTTGTTCCCCCTTAGG,  downstream forward: _UP4_TAAAAACCGTTCTATTGGAC
BKK32030 (Δ[gene|E98078C3CB9F19949009A8E50340E4C9E67663E6|yuiG]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK32030 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCGTTGTTCCCCCTTAGG,  downstream forward: _UP4_TAAAAACCGTTCTATTGGAC
References
Reviews
20497229,22574898,24362466
Original Publications
18763711,22891302,11717296,39686976

E98078C3CB9F19949009A8E50340E4C9E67663E6

Page visits: 3644

Time of last update: 2025-10-26 16:01:03

Author of last update: Jstuelk