

regulatory leader peptide for the control of [gene|67C0C9EA17EF953554D3D57CD0D285246F50C1AD|bmrC]-[gene|9B2766D2F8892AA17DB480216570C81C33355C3B|bmrD] expression

Molecular weight
6.18 kDa
Protein length
Gene length
control of [gene|67C0C9EA17EF953554D3D57CD0D285246F50C1AD|bmrC]-[gene|9B2766D2F8892AA17DB480216570C81C33355C3B|bmrD] expression
leader peptide
bmrB, yheJ

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms

This gene is a member of the following regulons

1,045,037 → 1,045,198
The protein
Expression and Regulation
''[protein|search|bmrB]-[protein|search|bmrC]-[protein|search|bmrD]'' expression only occurs during the late-exponential and stationary growth stages ([protein|search|AbrB]) [Pubmed|25217586]
regulatory mechanism
[protein|E5110D9C36E8C55AFD1419987B14A53232165F20|abrB]: repression, [Pubmed|20817675,25217586], in [regulon|protein:E5110D9C36E8C55AFD1419987B14A53232165F20|abrB regulon]
[protein|E9956A958C66C4114EB974EA6F9BF30CD951034A|bmrB]: attenuation, [Pubmed|25217586], in [regulon|protein:E9956A958C66C4114EB974EA6F9BF30CD951034A|bmrB regulon]
Open in new tab


2022-11-28 19:38:36





Biological materials
MGNA-A706 (yheJ::erm), available at the [ NBRP B. subtilis, Japan]
BKE09700 (Δ[gene|E9956A958C66C4114EB974EA6F9BF30CD951034A|bmrB]::erm  trpC2) available at [ BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CACGCAAATTCCTTGGCATA,  downstream forward: _UP4_TAAGGAAAGACAGGTGTATG
BKK09700 (Δ[gene|E9956A958C66C4114EB974EA6F9BF30CD951034A|bmrB]::kan  trpC2) available at [ BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CACGCAAATTCCTTGGCATA,  downstream forward: _UP4_TAAGGAAAGACAGGTGTATG


Page visits: 2580

Time of last update: 2022-11-27 10:29:22

Author of last update: Jstuelk