ywhL

ywhL
168

unknown

locus
BSU_37440
Molecular weight
49.42 kDa
pI
3.98
Protein length
Gene length
function
unknown
product
unknown
essential
no
synonyms
ywhL

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG3391

This gene is a member of the following regulons

Gene
Coordinates
3,843,001 → 3,844,377
The protein
Structure
[PDB|1L0Q] (from Methanosarcina mazei, corresponds to aa 159 ... 455, 27% identity) [pubmed|12377130]
[AF|P71004]
Expression and Regulation
Operons
genes
[gene|48AFD558E71531CDBDC3983B36702819D1548E63|ywhK]-[gene|E9B2B4E505209AC9A6EA9EF5F7707E7405DC5335|ywhL]
description
[Pubmed|22383849]
Open in new tab

[gene|48AFD558E71531CDBDC3983B36702819D1548E63|ywhK]→[gene|E9B2B4E505209AC9A6EA9EF5F7707E7405DC5335|ywhL]

2022-11-24 23:26:25

Jstuelk

14

7cb164186d7dc2491818b86a310906671b0ad251

702679E9CAD6839B65B27EA059147788913956CC

Biological materials
Mutant
MGNA-A524 (ywhL::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/524 NBRP B. subtilis, Japan]
BKE37440 (Δ[gene|E9B2B4E505209AC9A6EA9EF5F7707E7405DC5335|ywhL]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE37440 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGATTTCACGTCCTTTTA,  downstream forward: _UP4_TCTGCGATTGCGATGTAGCT
BKK37440 (Δ[gene|E9B2B4E505209AC9A6EA9EF5F7707E7405DC5335|ywhL]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK37440 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGATTTCACGTCCTTTTA,  downstream forward: _UP4_TCTGCGATTGCGATGTAGCT
References
Research papers
12377130

E9B2B4E505209AC9A6EA9EF5F7707E7405DC5335

Page visits: 874

Time of last update: 2022-11-28 01:25:49

Author of last update: Jstuelk